Incidental Mutation 'R5457:Grb14'
ID432792
Institutional Source Beutler Lab
Gene Symbol Grb14
Ensembl Gene ENSMUSG00000026888
Gene Namegrowth factor receptor bound protein 14
Synonyms
MMRRC Submission 043020-MU
Accession Numbers

Ncbi RefSeq: NM_016719.1; MGI:1355324

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5457 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location64912476-65024987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64917098 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 43 (C43S)
Ref Sequence ENSEMBL: ENSMUSP00000121571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028252] [ENSMUST00000149193] [ENSMUST00000150643]
Predicted Effect probably benign
Transcript: ENSMUST00000028252
AA Change: C409S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028252
Gene: ENSMUSG00000026888
AA Change: C409S

DomainStartEndE-ValueType
RA 104 190 2.88e-23 SMART
PH 233 342 1.91e-10 SMART
Pfam:BPS 367 415 1.5e-31 PFAM
SH2 435 524 5.34e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134020
Predicted Effect probably benign
Transcript: ENSMUST00000149193
AA Change: C18S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000118115
Gene: ENSMUSG00000026888
AA Change: C18S

DomainStartEndE-ValueType
Pfam:BPS 1 24 3e-13 PFAM
SH2 44 108 2.54e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150643
AA Change: C43S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121571
Gene: ENSMUSG00000026888
AA Change: C43S

DomainStartEndE-ValueType
Pfam:BPS 1 49 3.1e-34 PFAM
SCOP:d1a81a2 51 93 3e-8 SMART
Blast:RA 61 93 1e-12 BLAST
PDB:2AUG|B 65 93 4e-12 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype Strain: 3029164
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous mutation of this gene results in improved glucose tolerance, lower circulating insulin levels and increased incorporation of glucose into glycogen in the liver and skeletal muscle of males. Both males and females exhibit a decrease in body size. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Grb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Grb14 APN 2 64914718 missense probably damaging 1.00
IGL02267:Grb14 APN 2 64953616 missense probably damaging 1.00
IGL02902:Grb14 APN 2 64938418 missense probably damaging 1.00
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0658:Grb14 UTSW 2 64914727 nonsense probably null
R0681:Grb14 UTSW 2 64917287 missense probably damaging 1.00
R1215:Grb14 UTSW 2 64917264 missense probably benign 0.01
R1781:Grb14 UTSW 2 64975555 critical splice donor site probably null
R1932:Grb14 UTSW 2 64912802 missense probably damaging 1.00
R2034:Grb14 UTSW 2 64923529 splice site probably benign
R4405:Grb14 UTSW 2 64953622 missense probably damaging 1.00
R4505:Grb14 UTSW 2 65022568 missense probably damaging 0.97
R4580:Grb14 UTSW 2 64953603 missense probably benign 0.29
R5216:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5367:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5369:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5382:Grb14 UTSW 2 64914734 missense probably damaging 1.00
R5816:Grb14 UTSW 2 64917284 missense probably damaging 1.00
R6062:Grb14 UTSW 2 65022620 missense possibly damaging 0.77
R7114:Grb14 UTSW 2 64916853 missense probably damaging 1.00
X0021:Grb14 UTSW 2 64936425 missense probably null 0.26
Predicted Primers PCR Primer
(F):5'- CTGGAAATTCTGTGGTGAAACC -3'
(R):5'- TAGCAATGGACTTCTCAGGTG -3'

Sequencing Primer
(F):5'- TTGGGACCGATGGAGAGCTG -3'
(R):5'- CTCAGGTGAGAAGAGCAGAGTC -3'
Posted On2016-10-06