Incidental Mutation 'R5457:Vmn2r50'
ID432815
Institutional Source Beutler Lab
Gene Symbol Vmn2r50
Ensembl Gene ENSMUSG00000094606
Gene Namevomeronasal 2, receptor 50
SynonymsEG434117
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5457 (G1)
Quality Score180
Status Not validated
Chromosome7
Chromosomal Location10037235-10053178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10047946 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 291 (T291A)
Ref Sequence ENSEMBL: ENSMUSP00000083478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074943] [ENSMUST00000086298]
Predicted Effect probably damaging
Transcript: ENSMUST00000074943
AA Change: T307A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074476
Gene: ENSMUSG00000094606
AA Change: T307A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.4e-32 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 597 833 1.3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086298
AA Change: T291A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083478
Gene: ENSMUSG00000094606
AA Change: T291A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 452 7e-31 PFAM
Pfam:NCD3G 496 549 5.3e-19 PFAM
Pfam:7tm_3 579 818 3.9e-78 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Vmn2r50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Vmn2r50 APN 7 10037683 missense probably damaging 1.00
IGL01739:Vmn2r50 APN 7 10037437 missense probably damaging 1.00
IGL02351:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02358:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02871:Vmn2r50 APN 7 10047787 missense possibly damaging 0.91
IGL02962:Vmn2r50 APN 7 10050325 missense probably damaging 1.00
IGL03187:Vmn2r50 APN 7 10037441 missense probably damaging 1.00
IGL03346:Vmn2r50 APN 7 10046002 missense probably damaging 0.99
PIT4651001:Vmn2r50 UTSW 7 10037732 missense probably benign 0.30
R0530:Vmn2r50 UTSW 7 10047717 missense possibly damaging 0.82
R1291:Vmn2r50 UTSW 7 10037477 missense probably damaging 0.98
R1438:Vmn2r50 UTSW 7 10050135 nonsense probably null
R1713:Vmn2r50 UTSW 7 10037804 missense probably damaging 1.00
R1747:Vmn2r50 UTSW 7 10047678 missense probably benign 0.20
R1750:Vmn2r50 UTSW 7 10052988 missense possibly damaging 0.69
R1918:Vmn2r50 UTSW 7 10047683 missense probably benign 0.03
R2435:Vmn2r50 UTSW 7 10053099 missense probably benign 0.27
R2511:Vmn2r50 UTSW 7 10047713 missense possibly damaging 0.81
R3795:Vmn2r50 UTSW 7 10037924 missense probably benign 0.18
R4156:Vmn2r50 UTSW 7 10040382 missense probably benign 0.12
R4332:Vmn2r50 UTSW 7 10052995 missense probably benign 0.32
R4399:Vmn2r50 UTSW 7 10047907 missense possibly damaging 0.81
R4411:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4412:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4413:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4645:Vmn2r50 UTSW 7 10037235 makesense probably null
R5151:Vmn2r50 UTSW 7 10053043 missense probably benign 0.00
R5175:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R5291:Vmn2r50 UTSW 7 10047825 missense probably damaging 1.00
R5559:Vmn2r50 UTSW 7 10037326 missense probably damaging 1.00
R5579:Vmn2r50 UTSW 7 10050089 missense probably benign 0.00
R5711:Vmn2r50 UTSW 7 10040372 missense possibly damaging 0.81
R5759:Vmn2r50 UTSW 7 10047978 missense probably damaging 1.00
R6004:Vmn2r50 UTSW 7 10050059 missense probably benign 0.00
R6394:Vmn2r50 UTSW 7 10040326 missense probably damaging 1.00
R6488:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R6762:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R6995:Vmn2r50 UTSW 7 10046037 nonsense probably null
R6998:Vmn2r50 UTSW 7 10037757 missense probably benign 0.03
R7019:Vmn2r50 UTSW 7 10050245 missense probably benign 0.01
R7027:Vmn2r50 UTSW 7 10047612 missense probably damaging 1.00
R7231:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R7343:Vmn2r50 UTSW 7 10050350 critical splice acceptor site probably null
R7554:Vmn2r50 UTSW 7 10050139 missense probably null 0.00
R7704:Vmn2r50 UTSW 7 10047738 missense probably benign 0.05
R7768:Vmn2r50 UTSW 7 10037371 missense probably damaging 0.99
R7773:Vmn2r50 UTSW 7 10037635 missense possibly damaging 0.70
X0067:Vmn2r50 UTSW 7 10053027 missense probably damaging 0.99
Z1088:Vmn2r50 UTSW 7 10037500 missense possibly damaging 0.91
Z1088:Vmn2r50 UTSW 7 10046159 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCATTTTACAGTTAGATGCTGAG -3'
(R):5'- GGAAACAAGGAAATTTGCTTTGCC -3'

Sequencing Primer
(F):5'- TTTTACAGTTAGATGCTGAGGATTC -3'
(R):5'- GCTTTGCCTTTGTGAAAATGATCTC -3'
Posted On2016-10-06