Incidental Mutation 'R5457:Gpt2'
ID 432821
Institutional Source Beutler Lab
Gene Symbol Gpt2
Ensembl Gene ENSMUSG00000031700
Gene Name glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms ALT2, 4631422C05Rik
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R5457 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 85492576-85527560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 85512338 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 267 (N267H)
Ref Sequence ENSEMBL: ENSMUSP00000034136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034136] [ENSMUST00000132932]
AlphaFold Q8BGT5
Predicted Effect possibly damaging
Transcript: ENSMUST00000034136
AA Change: N267H

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034136
Gene: ENSMUSG00000031700
AA Change: N267H

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:Aminotran_1_2 110 510 6.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132932
SMART Domains Protein: ENSMUSP00000115968
Gene: ENSMUSG00000031700

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
PDB:3IHJ|A 48 148 6e-63 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140189
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial alanine transaminase, a pyridoxal enzyme that catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate. Alanine transaminases play roles in gluconeogenesis and amino acid metabolism in many tissues including skeletal muscle, kidney, and liver. Activating transcription factor 4 upregulates this gene under metabolic stress conditions in hepatocyte cell lines. A loss of function mutation in this gene has been associated with developmental encephalopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity, reduced postnatal brain growth, various metabolic defects in pathways involving amino acid metabolism, the TCA cycle and neuroprotective mechanisms, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Gpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Gpt2 APN 8 85512324 missense probably benign
IGL01611:Gpt2 APN 8 85519538 nonsense probably null
IGL02385:Gpt2 APN 8 85516153 splice site probably null
IGL02484:Gpt2 APN 8 85516233 missense probably damaging 1.00
IGL02589:Gpt2 APN 8 85516166 nonsense probably null
IGL02669:Gpt2 APN 8 85523279 missense probably benign 0.02
R1191:Gpt2 UTSW 8 85509272 missense probably damaging 1.00
R1599:Gpt2 UTSW 8 85512234 missense probably damaging 1.00
R1944:Gpt2 UTSW 8 85517996 missense probably damaging 1.00
R1953:Gpt2 UTSW 8 85521384 missense probably benign 0.00
R1962:Gpt2 UTSW 8 85493135 missense probably damaging 0.99
R1982:Gpt2 UTSW 8 85516203 missense possibly damaging 0.75
R2283:Gpt2 UTSW 8 85516189 missense probably benign
R3785:Gpt2 UTSW 8 85525573 missense probably benign
R3786:Gpt2 UTSW 8 85525573 missense probably benign
R3787:Gpt2 UTSW 8 85525573 missense probably benign
R4402:Gpt2 UTSW 8 85525559 missense probably benign 0.32
R4974:Gpt2 UTSW 8 85519439 splice site probably benign
R5589:Gpt2 UTSW 8 85493111 missense probably damaging 1.00
R5734:Gpt2 UTSW 8 85523256 missense probably benign 0.17
R5924:Gpt2 UTSW 8 85493004 missense probably damaging 1.00
R6371:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6651:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6652:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6895:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6898:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6923:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6955:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6956:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7112:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7113:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7115:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7124:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7125:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7327:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7486:Gpt2 UTSW 8 85525606 missense probably damaging 0.98
R7582:Gpt2 UTSW 8 85519516 missense probably damaging 1.00
R7986:Gpt2 UTSW 8 85509210 nonsense probably null
R8274:Gpt2 UTSW 8 85516224 missense probably benign 0.38
R8376:Gpt2 UTSW 8 85493065 missense probably benign 0.00
X0058:Gpt2 UTSW 8 85518019 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGACAATCCTGAAGCTCCTGG -3'
(R):5'- AAGATACCAGCCTCTCATCTCCTG -3'

Sequencing Primer
(F):5'- ACGGACCGGCGTGATGATTC -3'
(R):5'- TCATCTCCTGAGGTGGCCTG -3'
Posted On 2016-10-06