Incidental Mutation 'R5457:Taar9'
ID432830
Institutional Source Beutler Lab
Gene Symbol Taar9
Ensembl Gene ENSMUSG00000037424
Gene Nametrace amine-associated receptor 9
SynonymsTar3, Ta3, Trar3
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5457 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24108488-24109534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24109105 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 144 (F144L)
Ref Sequence ENSEMBL: ENSMUSP00000043552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041180]
Predicted Effect probably damaging
Transcript: ENSMUST00000041180
AA Change: F144L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043552
Gene: ENSMUSG00000037424
AA Change: F144L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 326 7.3e-13 PFAM
Pfam:7tm_1 49 311 8.4e-61 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAAR9 is a member of a large family of rhodopsin G protein-coupled receptors (GPCRs, or GPRs). GPCRs contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins.[supplied by OMIM, Jul 2005]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Taar9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Taar9 APN 10 24109531 missense probably benign
IGL02011:Taar9 APN 10 24108579 missense possibly damaging 0.93
IGL02883:Taar9 APN 10 24109480 missense probably benign 0.08
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1468:Taar9 UTSW 10 24109484 missense possibly damaging 0.47
R1598:Taar9 UTSW 10 24109407 missense possibly damaging 0.90
R2072:Taar9 UTSW 10 24108979 missense probably damaging 1.00
R2471:Taar9 UTSW 10 24109391 missense probably benign 0.00
R2519:Taar9 UTSW 10 24109254 missense probably damaging 1.00
R4205:Taar9 UTSW 10 24108579 missense possibly damaging 0.93
R4793:Taar9 UTSW 10 24109510 missense probably benign
R4801:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R4802:Taar9 UTSW 10 24108843 missense probably damaging 0.97
R6450:Taar9 UTSW 10 24109240 missense probably damaging 1.00
R6601:Taar9 UTSW 10 24109047 missense probably damaging 1.00
R6915:Taar9 UTSW 10 24109012 missense possibly damaging 0.53
R7179:Taar9 UTSW 10 24108984 missense probably damaging 1.00
R7480:Taar9 UTSW 10 24108945 missense possibly damaging 0.61
R8200:Taar9 UTSW 10 24109419 missense probably damaging 0.99
Z1088:Taar9 UTSW 10 24108965 missense probably damaging 1.00
Z1177:Taar9 UTSW 10 24109141 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCCTGATACTTTGCCACC -3'
(R):5'- TGACAGTGATGCCCTTCAGC -3'

Sequencing Primer
(F):5'- CACCATGACCACAGTGGG -3'
(R):5'- TGCCCTTCAGCACGGTG -3'
Posted On2016-10-06