Incidental Mutation 'R0479:Glb1l3'
ID43284
Institutional Source Beutler Lab
Gene Symbol Glb1l3
Ensembl Gene ENSMUSG00000031966
Gene Namegalactosidase, beta 1 like 3
Synonyms
MMRRC Submission 038679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0479 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location26817953-26860890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26829093 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 314 (T314S)
Ref Sequence ENSEMBL: ENSMUSP00000147979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034448] [ENSMUST00000210274]
Predicted Effect probably benign
Transcript: ENSMUST00000034448
AA Change: T238S

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034448
Gene: ENSMUSG00000031966
AA Change: T238S

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 1 304 1.5e-110 PFAM
Pfam:Glyco_hydro_42 7 160 6.2e-11 PFAM
low complexity region 309 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209592
Predicted Effect probably benign
Transcript: ENSMUST00000210274
AA Change: T314S

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211353
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 98% (105/107)
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,332,145 V269A probably benign Het
Acsl1 G A 8: 46,531,072 G543R probably damaging Het
Adam18 T C 8: 24,651,822 N244D probably benign Het
Adgra3 C T 5: 49,990,265 V478M probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Arhgef10 A T 8: 14,991,070 E723V probably damaging Het
Arid3a C A 10: 79,951,294 N519K possibly damaging Het
Atrn T A 2: 130,999,165 Y1162* probably null Het
Cacng5 T A 11: 107,877,951 N172Y probably benign Het
Cct8 C T 16: 87,487,706 V198M probably damaging Het
Cep192 G A 18: 67,858,018 S1857N probably damaging Het
Cherp A T 8: 72,463,147 D657E possibly damaging Het
Clca2 T G 3: 145,090,849 D199A probably damaging Het
Cops7b A G 1: 86,605,076 T219A probably benign Het
Crb1 C T 1: 139,198,614 M1392I probably damaging Het
Csf3r A C 4: 126,043,823 E833D probably damaging Het
Cutc A G 19: 43,768,216 E247G probably damaging Het
Cyp2c38 A G 19: 39,463,005 L17P probably damaging Het
D430042O09Rik T C 7: 125,843,346 L809S probably benign Het
D5Ertd615e T A 5: 45,163,454 noncoding transcript Het
Ddx60 G T 8: 61,969,657 G643W probably damaging Het
Depdc1a C T 3: 159,520,860 T268I probably damaging Het
Dgke T C 11: 89,052,470 E231G probably benign Het
Dhrs7b T A 11: 60,855,687 probably benign Het
Dll3 A G 7: 28,301,549 V27A probably damaging Het
Dnmt3c T A 2: 153,714,941 probably null Het
Duox1 T C 2: 122,346,380 F1461L probably damaging Het
Enpep A G 3: 129,312,674 V301A possibly damaging Het
Eny2 T A 15: 44,435,604 probably null Het
Esr1 A G 10: 4,997,911 D488G probably damaging Het
Ets1 A G 9: 32,730,180 K110E probably damaging Het
Eya2 T A 2: 165,715,956 Y157* probably null Het
F830045P16Rik T G 2: 129,472,688 D223A possibly damaging Het
Fbxo18 A G 2: 11,758,419 Y475H probably damaging Het
Fbxo39 T C 11: 72,317,593 I257T probably damaging Het
Fkbp10 T C 11: 100,415,914 V23A probably damaging Het
Foxp3 A G X: 7,587,344 I128V possibly damaging Het
Fzd7 T C 1: 59,483,708 F250S probably damaging Het
Gaa A G 11: 119,281,236 T722A possibly damaging Het
Gemin5 A G 11: 58,139,551 V816A probably benign Het
H2-Ab1 A G 17: 34,264,968 E101G possibly damaging Het
Hydin A C 8: 110,599,088 T4710P probably damaging Het
Ica1 C T 6: 8,754,627 V48M probably damaging Het
Ica1 T C 6: 8,754,683 Y29C probably damaging Het
Ints7 T A 1: 191,614,554 probably null Het
Iqub T C 6: 24,505,810 E33G probably benign Het
Itgb1bp2 T A X: 101,449,200 C10S probably damaging Het
Kcnd1 T A X: 7,831,222 I391N possibly damaging Het
Kdm8 T C 7: 125,452,640 L135P probably damaging Het
Ksr1 T C 11: 79,025,283 D574G probably damaging Het
Lama5 C T 2: 180,184,457 R2331H probably benign Het
Larp1 C A 11: 58,042,820 N357K possibly damaging Het
Lgi3 C T 14: 70,534,552 probably benign Het
Lmbrd1 T A 1: 24,746,797 probably benign Het
Methig1 A T 15: 100,374,944 K53* probably null Het
Mfap3 T A 11: 57,529,643 I150N probably damaging Het
Mug1 A T 6: 121,840,227 Q85L probably benign Het
Npl A G 1: 153,515,409 V200A probably damaging Het
Nuf2 A T 1: 169,498,934 probably benign Het
Obscn A G 11: 59,112,707 V1255A probably damaging Het
Olfr186 C T 16: 59,027,128 V260M possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr916 T C 9: 38,658,182 D70G probably damaging Het
P2rx1 T C 11: 73,012,961 V283A probably damaging Het
Pex2 C A 3: 5,561,295 L151F probably damaging Het
Pias1 A G 9: 62,893,118 probably benign Het
Pmfbp1 A T 8: 109,530,473 probably benign Het
Pogz A G 3: 94,876,636 K545E possibly damaging Het
Ppp3cb T C 14: 20,503,241 probably null Het
Prl G A 13: 27,064,928 D189N probably damaging Het
Prpf6 A G 2: 181,651,127 N794S probably benign Het
Prr36 G A 8: 4,213,930 Q579* probably null Het
Ptprq A T 10: 107,643,994 Y1138* probably null Het
Rabepk A T 2: 34,785,580 H179Q probably damaging Het
Rest T C 5: 77,282,751 S1006P probably damaging Het
Rimklb A C 6: 122,464,216 probably benign Het
Rnpepl1 T C 1: 92,918,865 probably benign Het
Sacs T A 14: 61,191,479 L329Q probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Setd5 A T 6: 113,115,033 I272F probably damaging Het
Sgk1 G T 10: 21,996,310 A262S probably benign Het
Skint2 G A 4: 112,624,041 V34I possibly damaging Het
Skint5 G C 4: 113,655,672 Q888E unknown Het
Slc4a3 T C 1: 75,551,828 probably benign Het
Sox10 T C 15: 79,163,319 E133G probably damaging Het
Spryd3 G A 15: 102,130,400 R129* probably null Het
Stag1 T A 9: 100,928,091 N782K probably benign Het
Stam T C 2: 14,117,495 L132P probably damaging Het
Stard9 T A 2: 120,697,596 S1445T probably damaging Het
Syt5 C T 7: 4,543,109 R94Q probably benign Het
Tbc1d23 A T 16: 57,171,814 H594Q probably damaging Het
Tecta T A 9: 42,337,939 I1871F probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Thrb T C 14: 18,033,643 F469L probably damaging Het
Trove2 A T 1: 143,757,751 D536E possibly damaging Het
Tyr T C 7: 87,493,221 S44G possibly damaging Het
Usp20 T A 2: 31,017,475 V673E probably benign Het
Usp28 T C 9: 49,037,213 S873P probably damaging Het
Usp43 C T 11: 67,897,274 V306M possibly damaging Het
Wdr17 G T 8: 54,651,421 probably null Het
Wsb2 T G 5: 117,376,679 probably benign Het
Xkrx A T X: 134,150,966 L312Q probably damaging Het
Other mutations in Glb1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Glb1l3 APN 9 26853671 missense probably damaging 1.00
IGL00537:Glb1l3 APN 9 26829050 missense probably damaging 1.00
IGL01139:Glb1l3 APN 9 26818227 missense probably benign 0.00
IGL01397:Glb1l3 APN 9 26825195 missense probably benign
IGL01603:Glb1l3 APN 9 26859536 missense probably damaging 1.00
IGL01938:Glb1l3 APN 9 26818529 missense probably damaging 0.98
IGL02051:Glb1l3 APN 9 26825168 missense probably benign 0.39
IGL02105:Glb1l3 APN 9 26818527 missense probably damaging 0.99
IGL02132:Glb1l3 APN 9 26825170 missense probably benign 0.07
IGL02249:Glb1l3 APN 9 26831268 missense possibly damaging 0.60
IGL02363:Glb1l3 APN 9 26853644 missense probably damaging 1.00
IGL02824:Glb1l3 APN 9 26850109 missense probably damaging 1.00
IGL02938:Glb1l3 APN 9 26826759 missense probably benign 0.26
IGL03181:Glb1l3 APN 9 26828363 splice site probably null
IGL03288:Glb1l3 APN 9 26818305 missense probably damaging 0.99
IGL03299:Glb1l3 APN 9 26859452 missense probably damaging 1.00
R4036:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4037:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4038:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4039:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4797:Glb1l3 UTSW 9 26828446 missense probably damaging 0.96
R4840:Glb1l3 UTSW 9 26829053 missense probably benign 0.06
R5645:Glb1l3 UTSW 9 26824826 missense probably benign
R5907:Glb1l3 UTSW 9 26826383 missense probably damaging 1.00
R5916:Glb1l3 UTSW 9 26854736 missense probably benign 0.20
R6428:Glb1l3 UTSW 9 26859452 missense probably damaging 1.00
R6489:Glb1l3 UTSW 9 26826831 missense probably benign 0.31
R6532:Glb1l3 UTSW 9 26818442 missense probably benign 0.02
R6560:Glb1l3 UTSW 9 26828424 synonymous probably null
R6653:Glb1l3 UTSW 9 26859588 missense probably benign 0.09
R6802:Glb1l3 UTSW 9 26859352 intron probably null
R7347:Glb1l3 UTSW 9 26829003 missense probably benign
R7531:Glb1l3 UTSW 9 26853654 missense possibly damaging 0.62
R7542:Glb1l3 UTSW 9 26818195 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGCAGGTGAAAAGCCTCAATTCTCG -3'
(R):5'- AGAGCTGCAAGTTCCCGGACTTAG -3'

Sequencing Primer
(F):5'- CAATTCTCGGAACGGATTGC -3'
(R):5'- TCCCGGACTTAGTTTTCAAGAG -3'
Posted On2013-05-23