Incidental Mutation 'R5457:Angpt1'
ID432845
Institutional Source Beutler Lab
Gene Symbol Angpt1
Ensembl Gene ENSMUSG00000022309
Gene Nameangiopoietin 1
SynonymsAngiopoietin-1, 1110046O21Rik, Ang-1, ang1
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5457 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location42424723-42676977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42523520 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 146 (T146I)
Ref Sequence ENSEMBL: ENSMUSP00000022921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022921]
Predicted Effect probably damaging
Transcript: ENSMUST00000022921
AA Change: T146I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022921
Gene: ENSMUSG00000022309
AA Change: T146I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 194 254 N/A INTRINSIC
FBG 281 496 3.04e-132 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted glycoprotein that belongs to the angiopoietin family of vascular growth factors. The encoded protein is a ligand in the vascular tyrosine kinase signaling pathway and regulates the formation and stabilization of blood vessels. This protein also functions in striated muscles by promoting proliferation, migration and differentiation of skeletal myoblasts and plays an essential role in the vascular response to tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality by E12.5 and deficits in vascular development such as a reduction in vascular branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Lpin2 A G 17: 71,243,372 T672A probably damaging Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Angpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Angpt1 APN 15 42476467 missense possibly damaging 0.73
IGL02671:Angpt1 APN 15 42676394 missense possibly damaging 0.79
IGL02876:Angpt1 APN 15 42426977 missense possibly damaging 0.68
IGL03077:Angpt1 APN 15 42476422 nonsense probably null
IGL03334:Angpt1 APN 15 42496412 missense possibly damaging 0.94
R0226:Angpt1 UTSW 15 42468235 missense probably benign 0.01
R1774:Angpt1 UTSW 15 42523616 missense probably damaging 0.99
R1800:Angpt1 UTSW 15 42512404 missense probably damaging 0.96
R1967:Angpt1 UTSW 15 42438307 missense probably damaging 1.00
R4093:Angpt1 UTSW 15 42523545 missense probably damaging 1.00
R4477:Angpt1 UTSW 15 42468164 missense probably damaging 1.00
R4629:Angpt1 UTSW 15 42438400 missense probably benign 0.01
R4647:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4648:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4750:Angpt1 UTSW 15 42676401 missense probably benign 0.00
R5222:Angpt1 UTSW 15 42676334 missense probably damaging 1.00
R5386:Angpt1 UTSW 15 42438365 missense probably damaging 1.00
R5526:Angpt1 UTSW 15 42512341 missense probably damaging 1.00
R6154:Angpt1 UTSW 15 42523655 missense probably damaging 1.00
R6904:Angpt1 UTSW 15 42459740 missense probably benign 0.00
R7009:Angpt1 UTSW 15 42523595 missense possibly damaging 0.83
R7101:Angpt1 UTSW 15 42523569 missense probably benign 0.18
R7139:Angpt1 UTSW 15 42676351 missense probably damaging 1.00
R7234:Angpt1 UTSW 15 42459725 missense probably benign 0.25
R7830:Angpt1 UTSW 15 42676268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACTCATAGCTTGTCAAG -3'
(R):5'- CCTTGTAAACACTGCATGCCC -3'

Sequencing Primer
(F):5'- GTCAAGCACTCATTGTTGTTGTTAC -3'
(R):5'- CAACAGGGGAGGCTTTACTTATAATC -3'
Posted On2016-10-06