Incidental Mutation 'R5457:Lpin2'
ID432852
Institutional Source Beutler Lab
Gene Symbol Lpin2
Ensembl Gene ENSMUSG00000024052
Gene Namelipin 2
Synonyms2610511G02Rik
MMRRC Submission 043020-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock #R5457 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71182560-71249817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71243372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 672 (T672A)
Ref Sequence ENSEMBL: ENSMUSP00000119282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126681] [ENSMUST00000129635]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125665
Predicted Effect probably damaging
Transcript: ENSMUST00000126681
AA Change: T710A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118610
Gene: ENSMUSG00000024052
AA Change: T710A

DomainStartEndE-ValueType
Pfam:Lipin_N 39 148 1e-47 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 217 227 N/A INTRINSIC
low complexity region 398 420 N/A INTRINSIC
Pfam:Lipin_mid 504 596 6.1e-37 PFAM
LNS2 720 876 2.18e-107 SMART
low complexity region 924 930 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129635
AA Change: T672A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119282
Gene: ENSMUSG00000024052
AA Change: T672A

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 168 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 360 382 N/A INTRINSIC
LNS2 682 838 2.18e-107 SMART
low complexity region 886 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140150
Predicted Effect probably benign
Transcript: ENSMUST00000154507
SMART Domains Protein: ENSMUSP00000127035
Gene: ENSMUSG00000024052

DomainStartEndE-ValueType
Pfam:Lipin_mid 1 55 2.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mouse studies suggest that this gene functions during normal adipose tissue development and may play a role in human triglyceride metabolism. This gene represents a candidate gene for human lipodystrophy, characterized by loss of body fat, fatty liver, hypertriglyceridemia, and insulin resistance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop ataxia, impaired blance, and tremors with age and show altered cerebellar phospholipid composition and anemia. Mice show diet-induced hepatic triglyceride accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C A 8: 86,509,844 V1114L probably benign Het
Actr5 G A 2: 158,635,998 probably null Het
Adcy7 T C 8: 88,311,021 L239P probably damaging Het
Afg3l1 T A 8: 123,489,968 F315L possibly damaging Het
Agps A G 2: 75,854,252 Y188C probably benign Het
Akt1 T C 12: 112,657,091 T312A probably damaging Het
Ang2 T C 14: 51,195,835 Y30C probably damaging Het
Angpt1 G A 15: 42,523,520 T146I probably damaging Het
Atg16l1 T C 1: 87,775,091 S288P probably damaging Het
Atp1b2 C T 11: 69,602,732 G4R probably damaging Het
Best3 T C 10: 117,004,511 F282S probably damaging Het
Cdkn2b A G 4: 89,307,154 L98P probably damaging Het
Cenps A G 4: 149,131,637 probably null Het
Clec16a G T 16: 10,545,532 probably null Het
Cxcl13 A T 5: 95,956,971 M1L unknown Het
Dcun1d4 A T 5: 73,531,565 E149D probably damaging Het
Dlst G A 12: 85,122,140 probably null Het
Dock10 C A 1: 80,524,064 C1803F probably damaging Het
Dpp10 T A 1: 123,411,810 K329N possibly damaging Het
Drosha T G 15: 12,926,029 Y1235D probably benign Het
Eif2s3y G A Y: 1,016,057 G213D probably damaging Homo
Eps8 A T 6: 137,512,177 S408T probably damaging Het
Fam171a2 T C 11: 102,437,536 D799G possibly damaging Het
Fcho2 T C 13: 98,789,767 K103E probably damaging Het
Fcrlb T C 1: 170,912,157 T59A probably damaging Het
Fgd4 T C 16: 16,462,009 R395G probably benign Het
Gm14496 A T 2: 181,997,608 D497V probably damaging Het
Gpt2 A C 8: 85,512,338 N267H possibly damaging Het
Grb14 A T 2: 64,917,098 C43S probably damaging Het
Hjurp T TN 1: 88,266,525 probably null Het
Igkv8-16 A G 6: 70,386,705 V111A possibly damaging Het
Klra2 T A 6: 131,221,889 S230C possibly damaging Het
Lamb3 G A 1: 193,325,994 R245H probably damaging Het
Lamc3 A G 2: 31,931,985 E1315G probably benign Het
Mcoln3 T A 3: 146,128,122 I139N probably benign Het
Mcpt8 C T 14: 56,082,336 C219Y probably benign Het
Mug2 G T 6: 122,049,729 G541* probably null Het
Myo7b G T 18: 31,971,450 probably null Het
Olfr1406 A G 1: 173,183,613 S274P probably damaging Het
Olfr175-ps1 A T 16: 58,824,433 I92N probably damaging Het
Olfr204 T C 16: 59,314,850 I186V probably benign Het
Olfr418 C T 1: 173,270,574 S133L probably benign Het
Olfr872 A T 9: 20,260,278 Y146F probably damaging Het
Pclo C T 5: 14,676,143 probably benign Het
Pdk2 C T 11: 95,028,582 S289N probably damaging Het
Pex19 G T 1: 172,130,678 G75W probably damaging Het
Psma3 T G 12: 70,984,565 S26A probably benign Het
Pth1r A T 9: 110,726,454 I326N possibly damaging Het
Sbf2 T C 7: 110,312,830 T1670A probably benign Het
Scn10a A G 9: 119,694,127 Y67H probably damaging Het
Sec16a A T 2: 26,440,268 D578E probably benign Het
Soga3 A C 10: 29,196,724 I671L probably benign Het
Spta1 C T 1: 174,217,193 A1465V probably damaging Het
Taar9 A G 10: 24,109,105 F144L probably damaging Het
Tal1 T C 4: 115,068,580 V282A probably benign Het
Tbrg4 C T 11: 6,620,947 R175Q probably damaging Het
Tdp1 C T 12: 99,894,746 Q215* probably null Het
Thsd4 A T 9: 59,979,777 W921R probably damaging Het
Trrap A G 5: 144,849,977 E3462G probably damaging Het
Try4 T C 6: 41,303,421 S60P probably damaging Het
Ttn T C 2: 76,710,921 E25580G probably damaging Het
Ttn A T 2: 76,945,955 I1581N possibly damaging Het
Vmn2r50 T C 7: 10,047,946 T291A probably damaging Het
Zkscan14 T C 5: 145,201,359 D106G probably benign Het
Other mutations in Lpin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lpin2 APN 17 71243972 missense probably damaging 1.00
IGL01712:Lpin2 APN 17 71215068 missense probably damaging 1.00
IGL01727:Lpin2 APN 17 71246452 missense probably damaging 1.00
IGL01969:Lpin2 APN 17 71231507 missense probably benign 0.00
IGL02143:Lpin2 APN 17 71243926 missense probably damaging 1.00
IGL02600:Lpin2 APN 17 71238698 missense probably damaging 0.99
IGL02931:Lpin2 APN 17 71238683 missense probably damaging 1.00
aspen UTSW 17 71243970 nonsense probably null
R1570_Lpin2_218 UTSW 17 71245181 nonsense probably null
R0144:Lpin2 UTSW 17 71225076 missense probably damaging 1.00
R0165:Lpin2 UTSW 17 71246519 missense probably damaging 1.00
R0367:Lpin2 UTSW 17 71215022 missense probably damaging 1.00
R0648:Lpin2 UTSW 17 71229312 missense probably benign 0.01
R1564:Lpin2 UTSW 17 71225060 missense probably benign 0.01
R1570:Lpin2 UTSW 17 71245181 nonsense probably null
R1846:Lpin2 UTSW 17 71225069 missense probably benign 0.00
R3607:Lpin2 UTSW 17 71229392 missense probably damaging 1.00
R4006:Lpin2 UTSW 17 71246501 missense probably damaging 1.00
R4526:Lpin2 UTSW 17 71237378 splice site probably null
R4705:Lpin2 UTSW 17 71232143 unclassified probably benign
R4949:Lpin2 UTSW 17 71231339 missense probably damaging 1.00
R4970:Lpin2 UTSW 17 71231334 missense probably damaging 0.98
R5099:Lpin2 UTSW 17 71243970 nonsense probably null
R5100:Lpin2 UTSW 17 71243970 nonsense probably null
R5101:Lpin2 UTSW 17 71243970 nonsense probably null
R5152:Lpin2 UTSW 17 71245159 missense probably damaging 1.00
R5216:Lpin2 UTSW 17 71242760 missense probably damaging 1.00
R5321:Lpin2 UTSW 17 71246858 missense probably damaging 1.00
R5695:Lpin2 UTSW 17 71244803 missense probably damaging 1.00
R5786:Lpin2 UTSW 17 71230273 missense probably benign 0.03
R5869:Lpin2 UTSW 17 71232276 unclassified probably benign
R5894:Lpin2 UTSW 17 71246934 missense probably benign 0.39
R6116:Lpin2 UTSW 17 71243930 missense probably damaging 1.00
R6253:Lpin2 UTSW 17 71231269 missense probably damaging 1.00
R6280:Lpin2 UTSW 17 71232248 unclassified probably benign
R6443:Lpin2 UTSW 17 71241668 missense probably benign 0.25
R6528:Lpin2 UTSW 17 71244005 missense probably damaging 1.00
R6634:Lpin2 UTSW 17 71246418 missense probably damaging 1.00
R6828:Lpin2 UTSW 17 71222128 missense probably damaging 1.00
R6885:Lpin2 UTSW 17 71215150 missense probably damaging 1.00
R6930:Lpin2 UTSW 17 71244791 missense probably damaging 1.00
R7067:Lpin2 UTSW 17 71244858 missense possibly damaging 0.72
R7583:Lpin2 UTSW 17 71231396 nonsense probably null
R7806:Lpin2 UTSW 17 71245171 missense probably damaging 1.00
R7840:Lpin2 UTSW 17 71230274 missense probably benign 0.14
R8011:Lpin2 UTSW 17 71230375 missense probably benign 0.43
R8553:Lpin2 UTSW 17 71231237 missense probably damaging 1.00
R8879:Lpin2 UTSW 17 71242754 missense probably damaging 1.00
R8947:Lpin2 UTSW 17 71204876 missense probably benign 0.44
Z1176:Lpin2 UTSW 17 71225211 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTACATGCTGGCACCAGAG -3'
(R):5'- TGTACTGCACACACGTCCTC -3'

Sequencing Primer
(F):5'- TGCTGGCACCAGAGAAACC -3'
(R):5'- AGCCATGGAGTGACTTCCCTTG -3'
Posted On2016-10-06