Incidental Mutation 'R5458:Gnas'
ID432858
Institutional Source Beutler Lab
Gene Symbol Gnas
Ensembl Gene ENSMUSG00000027523
Gene NameGNAS (guanine nucleotide binding protein, alpha stimulating) complex locus
SynonymsGnasxl, C130027O20Rik, 5530400H20Rik, Nespl, Nesp, A930027G11Rik, Gs alpha, G alpha s, Gsa, Nesp55, Galphas, Gnas1, P1, Gs-alpha, XLalphas, P3, neuroendocrine-specific Golgi protein p55 isoform 1, Oedsml, P2
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174284320-174346744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174298331 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 98 (I98V)
Ref Sequence ENSEMBL: ENSMUSP00000139839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080493] [ENSMUST00000087876] [ENSMUST00000087877] [ENSMUST00000109088] [ENSMUST00000109095] [ENSMUST00000109096] [ENSMUST00000130761] [ENSMUST00000130940] [ENSMUST00000180362] [ENSMUST00000185956] [ENSMUST00000186907]
Predicted Effect unknown
Transcript: ENSMUST00000080493
AA Change: Y157C
SMART Domains Protein: ENSMUSP00000079341
Gene: ENSMUSG00000027523
AA Change: Y157C

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087876
AA Change: Y157C
SMART Domains Protein: ENSMUSP00000085184
Gene: ENSMUSG00000027523
AA Change: Y157C

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 2.42e-8 PROSPERO
internal_repeat_1 209 276 2.42e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1118 8.32e-191 SMART
Predicted Effect unknown
Transcript: ENSMUST00000087877
AA Change: Y157C
SMART Domains Protein: ENSMUSP00000085185
Gene: ENSMUSG00000027523
AA Change: Y157C

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 1.1e-8 PROSPERO
internal_repeat_1 209 276 1.1e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
Blast:G_alpha 759 799 2e-14 BLAST
low complexity region 802 816 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109088
AA Change: I98V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104716
Gene: ENSMUSG00000027523
AA Change: I98V

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109095
SMART Domains Protein: ENSMUSP00000104723
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109096
SMART Domains Protein: ENSMUSP00000104724
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130761
Predicted Effect probably benign
Transcript: ENSMUST00000130940
SMART Domains Protein: ENSMUSP00000118210
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 59 1.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154658
Predicted Effect probably benign
Transcript: ENSMUST00000180362
SMART Domains Protein: ENSMUSP00000136180
Gene: ENSMUSG00000027523

DomainStartEndE-ValueType
Pfam:NESP55 1 253 1.2e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184327
Predicted Effect unknown
Transcript: ENSMUST00000185956
AA Change: Y157C
SMART Domains Protein: ENSMUSP00000140174
Gene: ENSMUSG00000027523
AA Change: Y157C

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
internal_repeat_1 89 166 3.02e-8 PROSPERO
internal_repeat_1 209 276 3.02e-8 PROSPERO
low complexity region 350 365 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 459 477 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
low complexity region 535 570 N/A INTRINSIC
low complexity region 576 626 N/A INTRINSIC
low complexity region 633 643 N/A INTRINSIC
low complexity region 659 678 N/A INTRINSIC
low complexity region 685 696 N/A INTRINSIC
G_alpha 759 1132 5.01e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186907
AA Change: I98V

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139839
Gene: ENSMUSG00000027523
AA Change: I98V

DomainStartEndE-ValueType
low complexity region 192 209 N/A INTRINSIC
low complexity region 336 352 N/A INTRINSIC
low complexity region 402 415 N/A INTRINSIC
low complexity region 421 446 N/A INTRINSIC
low complexity region 459 481 N/A INTRINSIC
low complexity region 493 510 N/A INTRINSIC
low complexity region 529 599 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
low complexity region 700 716 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mutant homozygotes stop developing normally by embryonic day 10.5 and die prenatally. On some backgrounds heterozygotes show imprinted phenotypes, including differences in body shape/weight, locomotor activity, metabolism, and developmental anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Gnas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Gnas APN 2 174341711 splice site probably benign
IGL00928:Gnas APN 2 174297953 nonsense probably null
IGL01014:Gnas APN 2 174297974 utr 5 prime probably benign
IGL01743:Gnas APN 2 174298332 nonsense probably null
IGL01808:Gnas APN 2 174298697 missense probably damaging 0.96
IGL02559:Gnas APN 2 174341936 splice site probably benign
R0555:Gnas UTSW 2 174298511 missense possibly damaging 0.78
R0627:Gnas UTSW 2 174298135 intron probably benign
R1418:Gnas UTSW 2 174345214 splice site probably benign
R1706:Gnas UTSW 2 174299975 missense possibly damaging 0.90
R1751:Gnas UTSW 2 174297894 utr 5 prime probably benign
R1968:Gnas UTSW 2 174298733 missense probably damaging 0.96
R2290:Gnas UTSW 2 174300010 missense probably benign 0.09
R4125:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4128:Gnas UTSW 2 174300165 missense possibly damaging 0.94
R4697:Gnas UTSW 2 174298080 missense probably damaging 1.00
R4888:Gnas UTSW 2 174298089 missense possibly damaging 0.94
R5640:Gnas UTSW 2 174284971 missense probably benign 0.44
R5696:Gnas UTSW 2 174299675 intron probably benign
R5757:Gnas UTSW 2 174345247 missense probably damaging 1.00
R6053:Gnas UTSW 2 174299852 missense possibly damaging 0.89
R6083:Gnas UTSW 2 174297862 start codon destroyed probably null
R6736:Gnas UTSW 2 174334251 missense probably damaging 0.98
R7074:Gnas UTSW 2 174285049 missense probably damaging 1.00
R7239:Gnas UTSW 2 174298615 missense unknown
R7541:Gnas UTSW 2 174298099 missense unknown
R7679:Gnas UTSW 2 174284831 missense probably damaging 0.99
R7694:Gnas UTSW 2 174300212 missense probably damaging 1.00
R7713:Gnas UTSW 2 174299027 missense unknown
X0022:Gnas UTSW 2 174299744 missense probably benign 0.33
Z1088:Gnas UTSW 2 174298373 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCTGACATCCAAAGCCCCTG -3'
(R):5'- GGAAGCCAGCGTTTTCAAATC -3'

Sequencing Primer
(F):5'- CTTCGAGGAAGTCCGAGTG -3'
(R):5'- AAATCTGATGTTCCCGGGC -3'
Posted On2016-10-06