Incidental Mutation 'R5458:Skint2'
ID432864
Institutional Source Beutler Lab
Gene Symbol Skint2
Ensembl Gene ENSMUSG00000034359
Gene Nameselection and upkeep of intraepithelial T cells 2
SynonymsB7S3, OTTMUSG00000008540
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112557194-112652248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112624180 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 80 (H80R)
Ref Sequence ENSEMBL: ENSMUSP00000139831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058791] [ENSMUST00000106560] [ENSMUST00000186969]
Predicted Effect probably benign
Transcript: ENSMUST00000058791
AA Change: H80R

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061011
Gene: ENSMUSG00000034359
AA Change: H80R

DomainStartEndE-ValueType
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 140 225 2.7e-10 PFAM
Pfam:Ig_2 153 231 3.6e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106559
SMART Domains Protein: ENSMUSP00000102169
Gene: ENSMUSG00000034359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 146 225 5.2e-8 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106560
AA Change: H80R

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102170
Gene: ENSMUSG00000034359
AA Change: H80R

DomainStartEndE-ValueType
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 1.3e-10 PFAM
Pfam:Ig_2 153 231 2e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186969
AA Change: H80R

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139831
Gene: ENSMUSG00000034359
AA Change: H80R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 2e-10 PFAM
Pfam:Ig_2 154 231 1.7e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 322 344 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Skint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Skint2 APN 4 112624212 missense probably damaging 1.00
IGL00801:Skint2 APN 4 112625991 missense possibly damaging 0.88
IGL01602:Skint2 APN 4 112625994 missense probably benign 0.44
IGL01605:Skint2 APN 4 112625994 missense probably benign 0.44
IGL02015:Skint2 APN 4 112624128 nonsense probably null
IGL02694:Skint2 APN 4 112616595 splice site probably benign
IGL03247:Skint2 APN 4 112626026 missense probably benign 0.06
PIT4677001:Skint2 UTSW 4 112625938 missense probably benign 0.10
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0190:Skint2 UTSW 4 112616532 missense possibly damaging 0.85
R0479:Skint2 UTSW 4 112624041 missense possibly damaging 0.47
R0625:Skint2 UTSW 4 112624086 missense probably damaging 1.00
R1143:Skint2 UTSW 4 112625936 missense probably benign 0.00
R1564:Skint2 UTSW 4 112625998 missense probably damaging 1.00
R1861:Skint2 UTSW 4 112647118 intron probably benign
R1864:Skint2 UTSW 4 112625909 missense probably benign 0.10
R3079:Skint2 UTSW 4 112639673 missense probably benign 0.01
R3891:Skint2 UTSW 4 112624186 missense probably damaging 1.00
R4422:Skint2 UTSW 4 112584588 intron probably benign
R4799:Skint2 UTSW 4 112652108 missense probably benign 0.07
R5482:Skint2 UTSW 4 112625879 missense probably damaging 1.00
R5603:Skint2 UTSW 4 112649764 missense possibly damaging 0.91
R7068:Skint2 UTSW 4 112624351 missense probably damaging 1.00
R7233:Skint2 UTSW 4 112625925 missense probably damaging 0.99
R7335:Skint2 UTSW 4 112624218 missense probably damaging 1.00
R7516:Skint2 UTSW 4 112625971 missense probably damaging 1.00
R7790:Skint2 UTSW 4 112616554 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CACACTGTTGTCATTTGACTATTGC -3'
(R):5'- AAATCTGAAAGGGATCCATGCC -3'

Sequencing Primer
(F):5'- TTGACTATTGCAATCCTTCACAG -3'
(R):5'- GGATCCATGCCTACCTGTGAC -3'
Posted On2016-10-06