Incidental Mutation 'R5458:Wdr95'
ID432870
Institutional Source Beutler Lab
Gene Symbol Wdr95
Ensembl Gene ENSMUSG00000029658
Gene NameWD40 repeat domain 95
Synonyms4930434E21Rik
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location149528679-149611894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 149564414 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 171 (P171L)
Ref Sequence ENSEMBL: ENSMUSP00000144385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110502] [ENSMUST00000201525] [ENSMUST00000202902]
Predicted Effect probably damaging
Transcript: ENSMUST00000110502
AA Change: P29L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106128
Gene: ENSMUSG00000029658
AA Change: P29L

DomainStartEndE-ValueType
Pfam:WD40 4 28 3.3e-3 PFAM
WD40 32 71 4.38e-5 SMART
WD40 120 159 3.27e-4 SMART
WD40 162 203 1.71e-7 SMART
WD40 206 249 3.57e0 SMART
WD40 263 301 1.7e-2 SMART
Blast:WD40 315 363 3e-14 BLAST
Blast:WD40 367 408 4e-13 BLAST
WD40 421 460 2.01e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201183
Predicted Effect silent
Transcript: ENSMUST00000201525
SMART Domains Protein: ENSMUSP00000144234
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
WD40 104 143 2e-6 SMART
WD40 146 187 1.1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202805
Predicted Effect probably damaging
Transcript: ENSMUST00000202902
AA Change: P171L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144385
Gene: ENSMUSG00000029658
AA Change: P171L

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Wdr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Wdr95 APN 5 149595244 critical splice acceptor site probably benign 0.00
IGL02352:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02359:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02478:Wdr95 APN 5 149596321 missense probably benign 0.02
IGL03078:Wdr95 APN 5 149611597 missense possibly damaging 0.63
IGL03201:Wdr95 APN 5 149581887 splice site probably null
P0037:Wdr95 UTSW 5 149588071 missense probably benign 0.27
R0115:Wdr95 UTSW 5 149564390 missense probably damaging 1.00
R0538:Wdr95 UTSW 5 149580806 missense probably damaging 1.00
R0606:Wdr95 UTSW 5 149588130 missense probably damaging 1.00
R0723:Wdr95 UTSW 5 149574048 missense probably damaging 1.00
R1104:Wdr95 UTSW 5 149606337 missense probably benign 0.00
R1233:Wdr95 UTSW 5 149581858 missense possibly damaging 0.61
R1233:Wdr95 UTSW 5 149595364 missense probably benign 0.00
R1344:Wdr95 UTSW 5 149588098 missense probably damaging 1.00
R1513:Wdr95 UTSW 5 149599294 missense probably benign 0.00
R1623:Wdr95 UTSW 5 149574116 missense probably damaging 1.00
R1633:Wdr95 UTSW 5 149593172 missense probably damaging 0.98
R1664:Wdr95 UTSW 5 149595287 missense probably damaging 0.98
R1686:Wdr95 UTSW 5 149593101 missense probably damaging 1.00
R1741:Wdr95 UTSW 5 149595396 splice site probably null
R1750:Wdr95 UTSW 5 149581886 splice site probably null
R1774:Wdr95 UTSW 5 149564392 nonsense probably null
R1831:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R1838:Wdr95 UTSW 5 149599366 missense probably benign 0.00
R1907:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R2019:Wdr95 UTSW 5 149574148 splice site probably benign
R2063:Wdr95 UTSW 5 149579162 splice site probably null
R2392:Wdr95 UTSW 5 149580670 missense probably benign 0.03
R2863:Wdr95 UTSW 5 149581856 nonsense probably null
R4116:Wdr95 UTSW 5 149597575 missense probably benign 0.02
R4237:Wdr95 UTSW 5 149563337 nonsense probably null
R4420:Wdr95 UTSW 5 149532666 missense probably damaging 0.99
R4639:Wdr95 UTSW 5 149581814 splice site probably benign
R4824:Wdr95 UTSW 5 149595332 missense probably damaging 1.00
R4911:Wdr95 UTSW 5 149611692 nonsense probably null
R5016:Wdr95 UTSW 5 149544801 missense probably benign 0.00
R5486:Wdr95 UTSW 5 149596330 nonsense probably null
R5613:Wdr95 UTSW 5 149584470 missense probably damaging 1.00
R5906:Wdr95 UTSW 5 149564227 missense possibly damaging 0.50
R5956:Wdr95 UTSW 5 149594482 missense probably benign 0.00
R6309:Wdr95 UTSW 5 149580803 critical splice acceptor site probably null
R6867:Wdr95 UTSW 5 149580923 intron probably null
R6964:Wdr95 UTSW 5 149581850 missense probably damaging 1.00
R7008:Wdr95 UTSW 5 149611540 missense probably benign 0.00
R7208:Wdr95 UTSW 5 149595371 missense probably benign 0.02
R7309:Wdr95 UTSW 5 149606293 missense probably benign 0.01
R7504:Wdr95 UTSW 5 149581846 missense probably damaging 0.99
R7660:Wdr95 UTSW 5 149594480 missense possibly damaging 0.86
X0024:Wdr95 UTSW 5 149588167 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACTGTGGGAGCAACAGATATC -3'
(R):5'- CCCTACAGTGAACTTTTAGAGGC -3'

Sequencing Primer
(F):5'- AATGTTGGGAAGAATGTCAAGATG -3'
(R):5'- GCTAAAAATAGAAATGTCCCAGGCTC -3'
Posted On2016-10-06