Incidental Mutation 'R5458:Chek1'
ID432881
Institutional Source Beutler Lab
Gene Symbol Chek1
Ensembl Gene ENSMUSG00000032113
Gene Namecheckpoint kinase 1
SynonymsChk1
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location36708482-36727065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36714429 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 307 (S307P)
Ref Sequence ENSEMBL: ENSMUSP00000134029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034625] [ENSMUST00000172702] [ENSMUST00000173963]
Predicted Effect probably benign
Transcript: ENSMUST00000034625
AA Change: S307P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034625
Gene: ENSMUSG00000032113
AA Change: S307P

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172702
AA Change: S307P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134388
Gene: ENSMUSG00000032113
AA Change: S307P

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173534
AA Change: S307P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134013
Gene: ENSMUSG00000032113
AA Change: S307P

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173963
AA Change: S307P

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134029
Gene: ENSMUSG00000032113
AA Change: S307P

DomainStartEndE-ValueType
S_TKc 9 265 4.79e-85 SMART
low complexity region 280 291 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174105
SMART Domains Protein: ENSMUSP00000134398
Gene: ENSMUSG00000032113

DomainStartEndE-ValueType
STYKc 1 99 4.6e-3 SMART
low complexity region 114 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174794
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality between E2.5 and E7.5, impaired cell cycle checkpoint function, increase in blastocyst apoptosis and lack of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Chek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Chek1 APN 9 36722599 splice site probably null
IGL01061:Chek1 APN 9 36714519 missense possibly damaging 0.70
IGL01322:Chek1 APN 9 36718421 nonsense probably null
IGL01627:Chek1 APN 9 36723895 missense probably damaging 1.00
IGL02379:Chek1 APN 9 36723946 missense probably benign 0.03
IGL03160:Chek1 APN 9 36722645 missense probably damaging 1.00
R0558:Chek1 UTSW 9 36712115 missense possibly damaging 0.72
R1035:Chek1 UTSW 9 36716473 missense probably damaging 1.00
R1466:Chek1 UTSW 9 36725857 missense probably damaging 1.00
R1466:Chek1 UTSW 9 36725857 missense probably damaging 1.00
R1606:Chek1 UTSW 9 36719524 missense probably damaging 1.00
R1627:Chek1 UTSW 9 36714441 missense probably benign
R2152:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2153:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2154:Chek1 UTSW 9 36723983 missense probably damaging 1.00
R2270:Chek1 UTSW 9 36719686 missense probably damaging 1.00
R4014:Chek1 UTSW 9 36722754 splice site probably benign
R5285:Chek1 UTSW 9 36714452 missense probably benign 0.00
R5547:Chek1 UTSW 9 36712104 missense probably benign 0.02
R5819:Chek1 UTSW 9 36710405 missense probably benign 0.01
R5853:Chek1 UTSW 9 36713687 missense probably damaging 1.00
R6334:Chek1 UTSW 9 36714492 missense possibly damaging 0.59
R6353:Chek1 UTSW 9 36723959 missense probably benign 0.01
R7319:Chek1 UTSW 9 36722643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGTGGGGAATAACTACATTTAAG -3'
(R):5'- CAGTCTATAAATGGATTTAGATGTGGC -3'

Sequencing Primer
(F):5'- CATTTAAGAAAAGGGCTTAATCTGC -3'
(R):5'- GATGTGGCTTTATTCAAATTGCTAG -3'
Posted On2016-10-06