Incidental Mutation 'R5458:Atp2c1'
ID432885
Institutional Source Beutler Lab
Gene Symbol Atp2c1
Ensembl Gene ENSMUSG00000032570
Gene NameATPase, Ca++-sequestering
SynonymsD930003G21Rik, SPCA, ATP2C1A, PMR1, 1700121J11Rik
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105403539-105527319 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 105414725 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 709 (Y709*)
Ref Sequence ENSEMBL: ENSMUSP00000135802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038118] [ENSMUST00000085133] [ENSMUST00000112558] [ENSMUST00000176770] [ENSMUST00000177074] [ENSMUST00000177293] [ENSMUST00000189758]
Predicted Effect probably null
Transcript: ENSMUST00000038118
AA Change: Y845*
SMART Domains Protein: ENSMUSP00000039103
Gene: ENSMUSG00000032570
AA Change: Y845*

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085133
AA Change: Y879*
SMART Domains Protein: ENSMUSP00000082220
Gene: ENSMUSG00000032570
AA Change: Y879*

DomainStartEndE-ValueType
Cation_ATPase_N 59 133 1.85e-14 SMART
Pfam:E1-E2_ATPase 138 372 3.4e-62 PFAM
Pfam:Hydrolase 377 689 2.6e-23 PFAM
Pfam:HAD 380 686 7.8e-14 PFAM
Pfam:Cation_ATPase 442 526 3.2e-19 PFAM
low complexity region 740 755 N/A INTRINSIC
Pfam:Cation_ATPase_C 759 931 3.8e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112557
Predicted Effect probably null
Transcript: ENSMUST00000112558
AA Change: Y845*
SMART Domains Protein: ENSMUSP00000108177
Gene: ENSMUSG00000032570
AA Change: Y845*

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175697
Predicted Effect probably null
Transcript: ENSMUST00000176770
AA Change: Y840*
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: Y840*

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177074
AA Change: Y845*
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: Y845*

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177293
AA Change: Y709*
SMART Domains Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570
AA Change: Y709*

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 203 6.7e-64 PFAM
Pfam:Hydrolase 207 519 7.4e-32 PFAM
Pfam:HAD 210 516 1.9e-15 PFAM
Pfam:Hydrolase_like2 272 356 3.8e-20 PFAM
transmembrane domain 564 586 N/A INTRINSIC
Pfam:Cation_ATPase_C 589 761 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190934
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth retardation, failure of rostral neural tube closure, Golgi and endoplasmic reticulum stress, increased apoptosis, accumulation of intracellular lipid droplets and midgestational lethality. Agedheterozygotes develop squamous cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Atp2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Atp2c1 APN 9 105418579 missense probably damaging 1.00
IGL01682:Atp2c1 APN 9 105452842 missense probably damaging 1.00
IGL01874:Atp2c1 APN 9 105448825 missense probably damaging 1.00
IGL02299:Atp2c1 APN 9 105461087 unclassified probably benign
IGL03186:Atp2c1 APN 9 105413130 missense probably benign 0.10
IGL03212:Atp2c1 APN 9 105445267 missense probably damaging 1.00
IGL02799:Atp2c1 UTSW 9 105413043 unclassified probably benign
IGL03047:Atp2c1 UTSW 9 105521007 intron probably benign
R0885:Atp2c1 UTSW 9 105421573 critical splice donor site probably null
R1072:Atp2c1 UTSW 9 105459744 missense possibly damaging 0.92
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1611:Atp2c1 UTSW 9 105442852 missense probably damaging 0.98
R1638:Atp2c1 UTSW 9 105432698 missense probably damaging 0.96
R1667:Atp2c1 UTSW 9 105432797 missense probably null 0.94
R1722:Atp2c1 UTSW 9 105439400 missense probably benign 0.01
R1734:Atp2c1 UTSW 9 105414655 missense probably damaging 1.00
R1782:Atp2c1 UTSW 9 105431587 missense probably damaging 0.99
R1964:Atp2c1 UTSW 9 105446123 missense probably damaging 1.00
R2008:Atp2c1 UTSW 9 105432726 missense probably benign 0.00
R2093:Atp2c1 UTSW 9 105418121 nonsense probably null
R3720:Atp2c1 UTSW 9 105422976 missense probably damaging 1.00
R4118:Atp2c1 UTSW 9 105466659 missense probably damaging 1.00
R4273:Atp2c1 UTSW 9 105435140 missense probably benign 0.10
R4763:Atp2c1 UTSW 9 105418567 missense probably damaging 1.00
R4962:Atp2c1 UTSW 9 105442950 missense probably benign 0.03
R5121:Atp2c1 UTSW 9 105448825 missense probably damaging 1.00
R5551:Atp2c1 UTSW 9 105459737 missense probably damaging 1.00
R6198:Atp2c1 UTSW 9 105521072 missense probably benign 0.00
R6414:Atp2c1 UTSW 9 105466656 missense probably damaging 1.00
R6432:Atp2c1 UTSW 9 105445313 missense probably damaging 1.00
R6675:Atp2c1 UTSW 9 105453533 critical splice donor site probably null
R6719:Atp2c1 UTSW 9 105424178 missense probably damaging 1.00
R6777:Atp2c1 UTSW 9 105418600 missense possibly damaging 0.64
R6847:Atp2c1 UTSW 9 105418579 missense probably damaging 1.00
R6870:Atp2c1 UTSW 9 105470062 missense probably benign 0.13
R7097:Atp2c1 UTSW 9 105464651 missense probably damaging 1.00
R7120:Atp2c1 UTSW 9 105420186 nonsense probably null
R7216:Atp2c1 UTSW 9 105467731 missense probably benign 0.00
R7284:Atp2c1 UTSW 9 105520809 intron probably null
R7365:Atp2c1 UTSW 9 105422999 missense probably damaging 1.00
R7448:Atp2c1 UTSW 9 105452783 missense probably damaging 0.98
X0053:Atp2c1 UTSW 9 105418684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAAGTCCCGCCAGTTATTTT -3'
(R):5'- AGTTGGGCTAGAATTTATCTTTAGTG -3'

Sequencing Primer
(F):5'- AAGTCCCGCCAGTTATTTTTCTCTTC -3'
(R):5'- CATTTCTGCTATCAGGGTG -3'
Posted On2016-10-06