Incidental Mutation 'R5458:Nlgn2'
ID432889
Institutional Source Beutler Lab
Gene Symbol Nlgn2
Ensembl Gene ENSMUSG00000051790
Gene Nameneuroligin 2
SynonymsNL2
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69823122-69837784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69827900 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 285 (Q285K)
Ref Sequence ENSEMBL: ENSMUSP00000104274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056484] [ENSMUST00000108634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056484
AA Change: Q285K

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053097
Gene: ENSMUSG00000051790
AA Change: Q285K

DomainStartEndE-ValueType
Pfam:COesterase 31 601 1.6e-199 PFAM
Pfam:Abhydrolase_3 180 372 4.8e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108634
AA Change: Q285K

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104274
Gene: ENSMUSG00000051790
AA Change: Q285K

DomainStartEndE-ValueType
Pfam:COesterase 30 601 2e-186 PFAM
Pfam:Abhydrolase_3 180 327 3.3e-9 PFAM
low complexity region 630 652 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
low complexity region 702 712 N/A INTRINSIC
low complexity region 713 731 N/A INTRINSIC
low complexity region 782 823 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000139893
AA Change: Q208K
SMART Domains Protein: ENSMUSP00000120428
Gene: ENSMUSG00000051790
AA Change: Q208K

DomainStartEndE-ValueType
Pfam:COesterase 1 262 9.3e-120 PFAM
Pfam:Abhydrolase_3 104 250 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140477
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional ready allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Nlgn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Nlgn2 APN 11 69825849 missense possibly damaging 0.78
IGL02649:Nlgn2 APN 11 69825802 missense probably benign 0.04
IGL02887:Nlgn2 APN 11 69827254 missense probably benign 0.24
IGL02904:Nlgn2 APN 11 69825840 missense possibly damaging 0.91
P0040:Nlgn2 UTSW 11 69825730 missense probably benign 0.01
R0800:Nlgn2 UTSW 11 69825997 missense possibly damaging 0.92
R1901:Nlgn2 UTSW 11 69825900 missense probably damaging 1.00
R1960:Nlgn2 UTSW 11 69827310 missense probably damaging 1.00
R1997:Nlgn2 UTSW 11 69828050 missense probably damaging 1.00
R2020:Nlgn2 UTSW 11 69828441 missense probably damaging 1.00
R2426:Nlgn2 UTSW 11 69827086 missense probably damaging 1.00
R3768:Nlgn2 UTSW 11 69828404 missense possibly damaging 0.95
R4584:Nlgn2 UTSW 11 69834278 missense possibly damaging 0.48
R4609:Nlgn2 UTSW 11 69834086 missense probably damaging 0.99
R5028:Nlgn2 UTSW 11 69827737 missense probably benign 0.11
R5141:Nlgn2 UTSW 11 69825390 missense probably damaging 1.00
R5149:Nlgn2 UTSW 11 69825390 missense probably damaging 1.00
R5150:Nlgn2 UTSW 11 69825390 missense probably damaging 1.00
R5930:Nlgn2 UTSW 11 69834149 missense probably damaging 1.00
R6823:Nlgn2 UTSW 11 69825924 missense probably damaging 1.00
R7096:Nlgn2 UTSW 11 69825690 missense probably damaging 1.00
R7310:Nlgn2 UTSW 11 69830583 missense possibly damaging 0.64
R7318:Nlgn2 UTSW 11 69825969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACATCCTGGTCCACTAGC -3'
(R):5'- TGAAAACATTGCCCACTTTGG -3'

Sequencing Primer
(F):5'- ACTAGCTCCCGGGAAGACTTC -3'
(R):5'- AAACATTGCCCACTTTGGAGGTG -3'
Posted On2016-10-06