Incidental Mutation 'R5458:Wsb1'
ID432890
Institutional Source Beutler Lab
Gene Symbol Wsb1
Ensembl Gene ENSMUSG00000017677
Gene NameWD repeat and SOCS box-containing 1
Synonyms
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79239372-79254671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79248436 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017821] [ENSMUST00000131848] [ENSMUST00000145772]
Predicted Effect probably damaging
Transcript: ENSMUST00000017821
AA Change: T145A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017821
Gene: ENSMUSG00000017677
AA Change: T145A

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-16 BLAST
WD40 117 156 8.4e-2 SMART
WD40 159 199 2.5e-10 SMART
WD40 203 242 5.9e-10 SMART
WD40 245 284 2.9e-11 SMART
WD40 300 339 1.2e-5 SMART
WD40 342 379 1.1e-4 SMART
SOCS 378 420 2.7e-18 SMART
SOCS_box 384 420 4.1e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131818
AA Change: T75A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131290
Gene: ENSMUSG00000017677
AA Change: T75A

DomainStartEndE-ValueType
WD40 48 87 1.33e1 SMART
WD40 90 130 3.72e-8 SMART
WD40 134 172 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131848
SMART Domains Protein: ENSMUSP00000128181
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137890
Predicted Effect probably benign
Transcript: ENSMUST00000145772
SMART Domains Protein: ENSMUSP00000137999
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 3e-19 BLAST
Meta Mutation Damage Score 0.1978 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Other mutations in Wsb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Wsb1 APN 11 79242041 missense probably damaging 1.00
IGL02352:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL02359:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL03218:Wsb1 APN 11 79248498 missense probably damaging 0.97
R0488:Wsb1 UTSW 11 79244500 missense probably damaging 1.00
R1051:Wsb1 UTSW 11 79246233 missense probably damaging 1.00
R1612:Wsb1 UTSW 11 79248585 missense probably benign 0.31
R2202:Wsb1 UTSW 11 79240386 missense probably benign
R2449:Wsb1 UTSW 11 79240352 missense probably benign
R4782:Wsb1 UTSW 11 79240373 missense probably benign 0.44
R4805:Wsb1 UTSW 11 79240391 missense possibly damaging 0.95
R4932:Wsb1 UTSW 11 79251000 missense probably damaging 0.96
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6140:Wsb1 UTSW 11 79241618 missense probably damaging 0.98
R6192:Wsb1 UTSW 11 79248510 missense possibly damaging 0.94
R6498:Wsb1 UTSW 11 79248489 missense probably damaging 1.00
R6545:Wsb1 UTSW 11 79251055 missense probably damaging 1.00
R6608:Wsb1 UTSW 11 79240362 missense probably benign 0.30
R7142:Wsb1 UTSW 11 79250988 missense probably benign 0.01
R7339:Wsb1 UTSW 11 79240358 missense probably damaging 0.97
R7361:Wsb1 UTSW 11 79240797 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATGTAAGACATTTTGCTGAGTCAG -3'
(R):5'- CAAGCTGTCTAAAATTGGCAAGAC -3'

Sequencing Primer
(F):5'- TAAGACCCAAACCTGCTTTGC -3'
(R):5'- GCTGTCTAAAATTGGCAAGACAAAAC -3'
Posted On2016-10-06