Incidental Mutation 'R5458:Ankfn1'
ID432891
Institutional Source Beutler Lab
Gene Symbol Ankfn1
Ensembl Gene ENSMUSG00000047773
Gene Nameankyrin-repeat and fibronectin type III domain containing 1
SynonymsLOC382543
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location89390223-89777653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89434810 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 512 (R512K)
Ref Sequence ENSEMBL: ENSMUSP00000132133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128717] [ENSMUST00000169201]
Predicted Effect unknown
Transcript: ENSMUST00000128717
AA Change: R532K
SMART Domains Protein: ENSMUSP00000121290
Gene: ENSMUSG00000047773
AA Change: R532K

DomainStartEndE-ValueType
ANK 136 167 2.47e2 SMART
ANK 173 204 1.46e-2 SMART
coiled coil region 205 236 N/A INTRINSIC
FN3 271 356 1.66e-7 SMART
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169201
AA Change: R512K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132133
Gene: ENSMUSG00000047773
AA Change: R512K

DomainStartEndE-ValueType
ANK 116 147 2.47e2 SMART
ANK 153 184 1.46e-2 SMART
coiled coil region 185 216 N/A INTRINSIC
FN3 251 336 1.66e-7 SMART
low complexity region 566 577 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207815
AA Change: R466K
Meta Mutation Damage Score 0.0792 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mutant mice exhibit a variable and subtle head nodding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Ankfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Ankfn1 APN 11 89391639 missense probably benign 0.01
IGL02519:Ankfn1 APN 11 89405678 missense probably benign
IGL02695:Ankfn1 APN 11 89391819 missense probably damaging 0.99
IGL02818:Ankfn1 APN 11 89538466 missense probably benign
IGL02821:Ankfn1 APN 11 89391616 missense probably benign 0.00
IGL03166:Ankfn1 APN 11 89538438 missense probably benign 0.19
R0056:Ankfn1 UTSW 11 89391676 missense possibly damaging 0.71
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0070:Ankfn1 UTSW 11 89392302 missense probably damaging 0.99
R0200:Ankfn1 UTSW 11 89441966 missense possibly damaging 0.67
R0427:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R0755:Ankfn1 UTSW 11 89392087 missense probably benign
R1240:Ankfn1 UTSW 11 89392134 missense probably damaging 0.99
R1534:Ankfn1 UTSW 11 89523151 missense probably damaging 1.00
R1539:Ankfn1 UTSW 11 89441391 missense probably damaging 1.00
R1548:Ankfn1 UTSW 11 89526541 missense probably damaging 0.98
R1595:Ankfn1 UTSW 11 89422767 critical splice donor site probably null
R1776:Ankfn1 UTSW 11 89526474 missense possibly damaging 0.74
R1835:Ankfn1 UTSW 11 89447618 missense probably benign 0.25
R2012:Ankfn1 UTSW 11 89405597 missense probably damaging 0.99
R2037:Ankfn1 UTSW 11 89456120 missense probably benign 0.13
R2175:Ankfn1 UTSW 11 89526537 missense probably damaging 1.00
R2876:Ankfn1 UTSW 11 89391636 missense possibly damaging 0.90
R3778:Ankfn1 UTSW 11 89441394 missense probably damaging 1.00
R4720:Ankfn1 UTSW 11 89441426 missense possibly damaging 0.50
R5001:Ankfn1 UTSW 11 89441442 missense possibly damaging 0.85
R5318:Ankfn1 UTSW 11 89391928 missense probably damaging 0.96
R5412:Ankfn1 UTSW 11 89505181 missense probably benign 0.17
R5434:Ankfn1 UTSW 11 89453187 missense probably damaging 1.00
R5710:Ankfn1 UTSW 11 89503925 missense probably benign 0.02
R6457:Ankfn1 UTSW 11 89391844 missense probably benign 0.00
R7026:Ankfn1 UTSW 11 89639577 makesense probably null
R7356:Ankfn1 UTSW 11 89434773 missense probably damaging 0.97
R7499:Ankfn1 UTSW 11 89391750 missense probably benign 0.12
R7572:Ankfn1 UTSW 11 89421271 missense probably benign
R7577:Ankfn1 UTSW 11 89503971 missense probably benign 0.04
R7582:Ankfn1 UTSW 11 89526619 missense probably benign 0.04
X0012:Ankfn1 UTSW 11 89425544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAATCGCAAATATCAGGAAATCG -3'
(R):5'- GCACATTTCTGCAGTCCCAC -3'

Sequencing Primer
(F):5'- GAGACTTCCTCTGGCTTT -3'
(R):5'- TCCCACCTACACTAAGTCTAAGTCTG -3'
Posted On2016-10-06