Mutagenetix > Incidental Mutation

Incidental Mutation 'R5458:Brca1'

432892

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

043021-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5458 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101517285 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1404 (N1404S)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

AlphaFold

P48754

Predicted Effect

possibly damaging
Transcript: ENSMUST00000017290
AA Change: N1404S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: N1404S

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acrbp	A	G	6: 125,050,050		probably benign	Het
Acsl5	A	G	19: 55,294,230	D589G	probably damaging	Het
Akap13	T	A	7: 75,586,301	L208Q	probably damaging	Het
Ankfn1	C	T	11: 89,434,810	R512K	probably benign	Het
Ankhd1	T	C	18: 36,648,485	S2197P	probably benign	Het
Ankrd27	A	G	7: 35,591,811	N11D	probably damaging	Het
Aspg	T	C	12: 112,120,002	V230A	probably damaging	Het
Atp2c1	A	T	9: 105,414,725	Y709*	probably null	Het
Atp8b2	T	C	3: 89,946,022	N748D	probably benign	Het
B4galnt3	A	G	6: 120,210,385	V684A	probably damaging	Het
Bco2	T	C	9: 50,545,344		probably null	Het
Bcr	T	C	10: 75,154,960	V766A	probably benign	Het
Chd1	A	G	17: 15,738,549	D621G	probably damaging	Het
Chek1	A	G	9: 36,714,429	S307P	probably benign	Het
Dhx29	T	C	13: 112,966,621	M1345T	probably benign	Het
Dnah6	T	A	6: 73,086,185	T2697S	probably damaging	Het
Ephb4	T	C	5: 137,369,852	V753A	probably damaging	Het
Fat1	T	C	8: 45,013,053	Y1427H	probably damaging	Het
Fggy	A	G	4: 95,926,743	Q445R	probably benign	Het
Fv1	A	G	4: 147,870,269	S431G	probably benign	Het
Gm5965	A	T	16: 88,778,507	R189S	probably benign	Het
Gnas	A	G	2: 174,298,331	I98V	probably benign	Het
Ino80	T	C	2: 119,412,429	N1086D	possibly damaging	Het
Lclat1	T	C	17: 73,239,919	L277P	probably damaging	Het
Lipc	T	C	9: 70,852,582		probably benign	Het
Myo3a	T	C	2: 22,245,550	I76T	probably damaging	Het
Nkpd1	C	A	7: 19,524,276	A510E	probably damaging	Het
Nlgn2	G	T	11: 69,827,900	Q285K	possibly damaging	Het
Olfr284	G	A	15: 98,340,365	A208V	probably benign	Het
Pax5	T	C	4: 44,679,526	D172G	probably damaging	Het
Pcdh15	T	A	10: 74,504,779	V1115D	probably damaging	Het
Pdzd7	T	C	19: 45,027,791	S964G	probably benign	Het
Phip	G	T	9: 82,926,500	P474Q	probably benign	Het
Pop5	C	T	5: 115,240,437		probably benign	Het
Ppfibp1	A	T	6: 147,012,435		probably benign	Het
Rdh11	C	T	12: 79,188,505	A106T	probably benign	Het
Rin3	A	G	12: 102,373,716	T642A	probably damaging	Het
Scmh1	C	T	4: 120,505,281		probably benign	Het
Skint2	A	G	4: 112,624,180	H80R	possibly damaging	Het
Spata16	A	T	3: 26,777,537	N265I	probably damaging	Het
Srpk1	T	C	17: 28,599,472		probably null	Het
Tcaf1	T	C	6: 42,686,542	T135A	probably benign	Het
Trappc12	A	G	12: 28,746,390	V381A	probably damaging	Het
Trim33	T	A	3: 103,330,180	I184K	possibly damaging	Het
Unc13a	C	T	8: 71,664,245	V62M	probably damaging	Het
Vrk2	A	G	11: 26,498,919	V225A	probably damaging	Het
Wdr66	A	G	5: 123,254,445		probably benign	Het
Wdr95	C	T	5: 149,564,414	P171L	probably damaging	Het
Wsb1	T	C	11: 79,248,436	T75A	probably damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGGACTAGGTCTAAGGTTCC -3'
(R):5'- TTCGTGGCACATCTCTCAGAG -3'

Sequencing Primer
(F):5'- AGGTCTAAGGTTCCCAAGTTACTCG -3'
(R):5'- GTGGCACATCTCTCAGAGTATATAAC -3'

Posted On

2016-10-06