Incidental Mutation 'R5458:Srpk1'
ID432901
Institutional Source Beutler Lab
Gene Symbol Srpk1
Ensembl Gene ENSMUSG00000004865
Gene Nameserine/arginine-rich protein specific kinase 1
SynonymsSR protein-specific kinase 1
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28587648-28622521 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 28599472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004987] [ENSMUST00000130643]
Predicted Effect probably benign
Transcript: ENSMUST00000004987
SMART Domains Protein: ENSMUSP00000004987
Gene: ENSMUSG00000004865

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 158 1.8e-12 PFAM
Pfam:Pkinase 8 160 1.5e-25 PFAM
low complexity region 169 183 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126683
Predicted Effect probably null
Transcript: ENSMUST00000130643
SMART Domains Protein: ENSMUSP00000116259
Gene: ENSMUSG00000004865

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 229 6.8e-11 PFAM
Pfam:Pkinase 80 231 5.6e-23 PFAM
low complexity region 241 255 N/A INTRINSIC
coiled coil region 264 297 N/A INTRINSIC
Pfam:Pkinase 468 646 3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145730
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/arginine protein kinase specific for the SR (serine/arginine-rich domain) family of splicing factors. The protein localizes to the nucleus and the cytoplasm. It is thought to play a role in regulation of both constitutive and alternative splicing by regulating intracellular localization of splicing factors. Alternative splicing of this gene results in multiple transcript variants. Additional alternatively spliced transcript variants have been described for this gene, but their full length nature have not been determined.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Srpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Srpk1 APN 17 28606317 missense probably damaging 1.00
IGL01792:Srpk1 APN 17 28599467 splice site probably benign
IGL03153:Srpk1 APN 17 28592266 missense possibly damaging 0.57
H8562:Srpk1 UTSW 17 28602733 missense probably benign 0.32
R0481:Srpk1 UTSW 17 28590244 splice site probably benign
R1160:Srpk1 UTSW 17 28599774 missense probably benign 0.05
R2188:Srpk1 UTSW 17 28594189 missense probably damaging 1.00
R4640:Srpk1 UTSW 17 28608724 missense probably benign
R4716:Srpk1 UTSW 17 28622008 missense probably benign 0.16
R4880:Srpk1 UTSW 17 28591225 missense probably damaging 0.98
R5533:Srpk1 UTSW 17 28602759 missense probably damaging 1.00
R6383:Srpk1 UTSW 17 28590062 missense probably damaging 1.00
R6766:Srpk1 UTSW 17 28602753 missense possibly damaging 0.85
R7483:Srpk1 UTSW 17 28594218 missense probably benign 0.11
R8074:Srpk1 UTSW 17 28622016 missense probably damaging 1.00
R8344:Srpk1 UTSW 17 28620424 missense unknown
R8416:Srpk1 UTSW 17 28594255 missense probably damaging 1.00
X0058:Srpk1 UTSW 17 28602835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCTGTCTACCCCATCC -3'
(R):5'- TCCACACTTTGAAGCAGGAACC -3'

Sequencing Primer
(F):5'- GTCTACCCCATCCCCACC -3'
(R):5'- TGAAGCAGGAACCTAGTTTCC -3'
Posted On2016-10-06