Incidental Mutation 'R5458:Lclat1'
ID432902
Institutional Source Beutler Lab
Gene Symbol Lclat1
Ensembl Gene ENSMUSG00000054469
Gene Namelysocardiolipin acyltransferase 1
SynonymsLycat, AGPAT8, ALCAT1
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73107985-73243368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73239919 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 277 (L277P)
Ref Sequence ENSEMBL: ENSMUSP00000068690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067545]
Predicted Effect probably damaging
Transcript: ENSMUST00000067545
AA Change: L277P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068690
Gene: ENSMUSG00000054469
AA Change: L277P

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
PlsC 79 201 8.7e-15 SMART
Pfam:Acyltransf_C 232 315 1e-20 PFAM
transmembrane domain 334 356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134149
Meta Mutation Damage Score 0.8949 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Male mice homozygous for a knock-out allele and fed a high fat diet exhibit resistance to diet induced obesity, decreased total body fat, increased insulin sensitivity, polyphagia, hyperactivity, increased energy expenditure, and increased fatty acid oxidation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Acsl5 A G 19: 55,294,230 D589G probably damaging Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Lclat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Lclat1 APN 17 73169533 missense probably benign 0.35
IGL03112:Lclat1 APN 17 73239747 missense probably damaging 1.00
R0270:Lclat1 UTSW 17 73240027 missense probably benign 0.33
R1661:Lclat1 UTSW 17 73188004 missense probably damaging 1.00
R1665:Lclat1 UTSW 17 73188004 missense probably damaging 1.00
R1674:Lclat1 UTSW 17 73239781 missense probably damaging 1.00
R1678:Lclat1 UTSW 17 73196720 missense probably damaging 0.97
R4785:Lclat1 UTSW 17 73240070 nonsense probably null
R6455:Lclat1 UTSW 17 73161833 missense probably damaging 0.99
R7063:Lclat1 UTSW 17 73239991 missense possibly damaging 0.58
R7635:Lclat1 UTSW 17 73161936 missense probably benign 0.01
X0028:Lclat1 UTSW 17 73169518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATGACATCACGGTCGC -3'
(R):5'- ATTCTCTCCTGCAGCACGAAG -3'

Sequencing Primer
(F):5'- TGACATCACGGTCGCATATC -3'
(R):5'- TGATTATAAAATACCACCGAACAGGG -3'
Posted On2016-10-06