Incidental Mutation 'R5458:Acsl5'
ID432905
Institutional Source Beutler Lab
Gene Symbol Acsl5
Ensembl Gene ENSMUSG00000024981
Gene Nameacyl-CoA synthetase long-chain family member 5
SynonymsFacl5, 1700030F05Rik
MMRRC Submission 043021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5458 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55251938-55297720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55294230 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 589 (D589G)
Ref Sequence ENSEMBL: ENSMUSP00000046585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043150] [ENSMUST00000076891] [ENSMUST00000224897] [ENSMUST00000225495] [ENSMUST00000225963] [ENSMUST00000226103]
Predicted Effect probably damaging
Transcript: ENSMUST00000043150
AA Change: D589G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046585
Gene: ENSMUSG00000024981
AA Change: D589G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:AMP-binding 82 548 2.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076891
SMART Domains Protein: ENSMUSP00000076157
Gene: ENSMUSG00000024982

DomainStartEndE-ValueType
transmembrane domain 19 41 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:zf-DHHC 94 244 3.2e-38 PFAM
SH3 316 397 5.84e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000224414
AA Change: D1G
Predicted Effect probably benign
Transcript: ENSMUST00000224897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225032
Predicted Effect probably benign
Transcript: ENSMUST00000225495
Predicted Effect probably benign
Transcript: ENSMUST00000225963
Predicted Effect probably benign
Transcript: ENSMUST00000226103
Meta Mutation Damage Score 0.9047 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit decreased mean bone mineral content and density measurements when compared with controls. A notably decreased mean platelet count is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrbp A G 6: 125,050,050 probably benign Het
Akap13 T A 7: 75,586,301 L208Q probably damaging Het
Ankfn1 C T 11: 89,434,810 R512K probably benign Het
Ankhd1 T C 18: 36,648,485 S2197P probably benign Het
Ankrd27 A G 7: 35,591,811 N11D probably damaging Het
Aspg T C 12: 112,120,002 V230A probably damaging Het
Atp2c1 A T 9: 105,414,725 Y709* probably null Het
Atp8b2 T C 3: 89,946,022 N748D probably benign Het
B4galnt3 A G 6: 120,210,385 V684A probably damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bcr T C 10: 75,154,960 V766A probably benign Het
Brca1 T C 11: 101,517,285 N1404S possibly damaging Het
Chd1 A G 17: 15,738,549 D621G probably damaging Het
Chek1 A G 9: 36,714,429 S307P probably benign Het
Dhx29 T C 13: 112,966,621 M1345T probably benign Het
Dnah6 T A 6: 73,086,185 T2697S probably damaging Het
Ephb4 T C 5: 137,369,852 V753A probably damaging Het
Fat1 T C 8: 45,013,053 Y1427H probably damaging Het
Fggy A G 4: 95,926,743 Q445R probably benign Het
Fv1 A G 4: 147,870,269 S431G probably benign Het
Gm5965 A T 16: 88,778,507 R189S probably benign Het
Gnas A G 2: 174,298,331 I98V probably benign Het
Ino80 T C 2: 119,412,429 N1086D possibly damaging Het
Lclat1 T C 17: 73,239,919 L277P probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Myo3a T C 2: 22,245,550 I76T probably damaging Het
Nkpd1 C A 7: 19,524,276 A510E probably damaging Het
Nlgn2 G T 11: 69,827,900 Q285K possibly damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pax5 T C 4: 44,679,526 D172G probably damaging Het
Pcdh15 T A 10: 74,504,779 V1115D probably damaging Het
Pdzd7 T C 19: 45,027,791 S964G probably benign Het
Phip G T 9: 82,926,500 P474Q probably benign Het
Pop5 C T 5: 115,240,437 probably benign Het
Ppfibp1 A T 6: 147,012,435 probably benign Het
Rdh11 C T 12: 79,188,505 A106T probably benign Het
Rin3 A G 12: 102,373,716 T642A probably damaging Het
Scmh1 C T 4: 120,505,281 probably benign Het
Skint2 A G 4: 112,624,180 H80R possibly damaging Het
Spata16 A T 3: 26,777,537 N265I probably damaging Het
Srpk1 T C 17: 28,599,472 probably null Het
Tcaf1 T C 6: 42,686,542 T135A probably benign Het
Trappc12 A G 12: 28,746,390 V381A probably damaging Het
Trim33 T A 3: 103,330,180 I184K possibly damaging Het
Unc13a C T 8: 71,664,245 V62M probably damaging Het
Vrk2 A G 11: 26,498,919 V225A probably damaging Het
Wdr66 A G 5: 123,254,445 probably benign Het
Wdr95 C T 5: 149,564,414 P171L probably damaging Het
Wsb1 T C 11: 79,248,436 T75A probably damaging Het
Other mutations in Acsl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Acsl5 APN 19 55272833 missense probably benign 0.02
IGL02792:Acsl5 APN 19 55293731 critical splice donor site probably null
lyrebird UTSW 19 55272819 nonsense probably null
paradise UTSW 19 55278183 missense
IGL02796:Acsl5 UTSW 19 55278169 nonsense probably null
R0206:Acsl5 UTSW 19 55280569 missense probably benign
R0400:Acsl5 UTSW 19 55293711 missense probably damaging 0.99
R0418:Acsl5 UTSW 19 55272806 missense probably benign 0.16
R0571:Acsl5 UTSW 19 55288911 intron probably benign
R0626:Acsl5 UTSW 19 55284472 missense probably benign 0.00
R0792:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1144:Acsl5 UTSW 19 55291843 missense probably damaging 1.00
R1477:Acsl5 UTSW 19 55291472 missense probably benign 0.23
R1522:Acsl5 UTSW 19 55280492 missense probably benign 0.01
R1927:Acsl5 UTSW 19 55278154 missense probably benign 0.37
R2495:Acsl5 UTSW 19 55293599 nonsense probably null
R4153:Acsl5 UTSW 19 55281463 missense probably benign 0.23
R4570:Acsl5 UTSW 19 55291774 missense probably damaging 0.99
R4721:Acsl5 UTSW 19 55280530 missense probably benign 0.00
R4834:Acsl5 UTSW 19 55280559 missense probably benign 0.00
R5270:Acsl5 UTSW 19 55294218 missense possibly damaging 0.50
R5360:Acsl5 UTSW 19 55291160 nonsense probably null
R5436:Acsl5 UTSW 19 55279565 critical splice donor site probably null
R5479:Acsl5 UTSW 19 55280462 missense probably damaging 1.00
R5812:Acsl5 UTSW 19 55294836 missense probably benign 0.01
R6232:Acsl5 UTSW 19 55280501 missense possibly damaging 0.69
R6821:Acsl5 UTSW 19 55288836 missense probably benign 0.03
R6874:Acsl5 UTSW 19 55291863 missense probably damaging 1.00
R7030:Acsl5 UTSW 19 55272819 nonsense probably null
R7156:Acsl5 UTSW 19 55268828 splice site probably null
R7293:Acsl5 UTSW 19 55291210 missense probably damaging 0.98
R7543:Acsl5 UTSW 19 55278183 missense
R7728:Acsl5 UTSW 19 55287853 nonsense probably null
R7977:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R7987:Acsl5 UTSW 19 55277973 critical splice donor site probably null
R8017:Acsl5 UTSW 19 55268796 missense probably benign
R8221:Acsl5 UTSW 19 55268830 critical splice donor site probably null
X0013:Acsl5 UTSW 19 55293664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGATCGGCTAGGGATTCG -3'
(R):5'- GTATGCATGCAACATTCTCTCG -3'

Sequencing Primer
(F):5'- ATCGGCTAGGGATTCGATTCTTTAC -3'
(R):5'- GCAACATTCTCTCGCAGCCATG -3'
Posted On2016-10-06