Incidental Mutation 'R5459:Armc9'
ID432910
Institutional Source Beutler Lab
Gene Symbol Armc9
Ensembl Gene ENSMUSG00000062590
Gene Namearmadillo repeat containing 9
Synonyms5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location86154780-86278284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86207972 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 550 (R550Q)
Ref Sequence ENSEMBL: ENSMUSP00000117267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027434] [ENSMUST00000113309] [ENSMUST00000131412] [ENSMUST00000150059] [ENSMUST00000156675]
Predicted Effect probably damaging
Transcript: ENSMUST00000027434
AA Change: R550Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027434
Gene: ENSMUSG00000062590
AA Change: R550Q

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 793 807 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113309
AA Change: R550Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108934
Gene: ENSMUSG00000062590
AA Change: R550Q

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 8e-14 SMART
low complexity region 794 808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123618
Predicted Effect probably damaging
Transcript: ENSMUST00000131412
AA Change: R550Q

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117267
Gene: ENSMUSG00000062590
AA Change: R550Q

DomainStartEndE-ValueType
LisH 7 39 1.8e-4 SMART
low complexity region 175 190 N/A INTRINSIC
coiled coil region 206 242 N/A INTRINSIC
SCOP:d1jdha_ 377 575 4e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135973
Predicted Effect possibly damaging
Transcript: ENSMUST00000150059
AA Change: R122Q

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116908
Gene: ENSMUSG00000062590
AA Change: R122Q

DomainStartEndE-ValueType
SCOP:d1qbkb_ 1 168 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155168
Predicted Effect possibly damaging
Transcript: ENSMUST00000156675
AA Change: R30Q

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119749
Gene: ENSMUSG00000062590
AA Change: R30Q

DomainStartEndE-ValueType
SCOP:d1qbkb_ 6 100 3e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Armc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Armc9 APN 1 86198339 missense probably damaging 1.00
IGL00771:Armc9 APN 1 86199835 splice site probably null
IGL01689:Armc9 APN 1 86274418 missense probably benign
IGL02143:Armc9 APN 1 86176865 missense possibly damaging 0.58
IGL02680:Armc9 APN 1 86252278 missense probably damaging 1.00
IGL02812:Armc9 APN 1 86244571 missense probably damaging 0.99
IGL02887:Armc9 APN 1 86164835 missense probably damaging 1.00
IGL03011:Armc9 APN 1 86199916 critical splice donor site probably null
IGL03309:Armc9 APN 1 86274433 missense possibly damaging 0.54
R0184:Armc9 UTSW 1 86198370 missense probably damaging 1.00
R0440:Armc9 UTSW 1 86194262 splice site probably null
R0787:Armc9 UTSW 1 86202505 missense probably damaging 0.99
R0849:Armc9 UTSW 1 86257270 missense probably benign 0.00
R1687:Armc9 UTSW 1 86156955 start codon destroyed probably null 1.00
R1962:Armc9 UTSW 1 86207974 missense probably damaging 1.00
R2176:Armc9 UTSW 1 86199892 missense probably damaging 1.00
R3418:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R3419:Armc9 UTSW 1 86194338 missense probably damaging 1.00
R4079:Armc9 UTSW 1 86213129 intron probably benign
R4112:Armc9 UTSW 1 86188939 missense possibly damaging 0.80
R4151:Armc9 UTSW 1 86164775 missense probably damaging 1.00
R4675:Armc9 UTSW 1 86202518 missense probably damaging 1.00
R4934:Armc9 UTSW 1 86213079 missense probably damaging 1.00
R4944:Armc9 UTSW 1 86274534 missense probably damaging 0.98
R5069:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5070:Armc9 UTSW 1 86257237 missense probably benign 0.03
R5071:Armc9 UTSW 1 86186116 missense probably benign 0.01
R5238:Armc9 UTSW 1 86199847 missense probably benign 0.01
R5386:Armc9 UTSW 1 86198289 missense probably null 1.00
R6027:Armc9 UTSW 1 86244667 missense probably damaging 1.00
R6144:Armc9 UTSW 1 86244579 missense probably benign 0.06
R7111:Armc9 UTSW 1 86159995 missense probably damaging 1.00
R7237:Armc9 UTSW 1 86164849 missense possibly damaging 0.82
R7304:Armc9 UTSW 1 86162715 missense probably benign
R7452:Armc9 UTSW 1 86213092 missense possibly damaging 0.87
R7555:Armc9 UTSW 1 86275678 missense probably damaging 1.00
R7805:Armc9 UTSW 1 86196319 missense probably damaging 1.00
R8490:Armc9 UTSW 1 86274403 missense probably benign 0.00
R8513:Armc9 UTSW 1 86162683 missense probably damaging 1.00
Z1177:Armc9 UTSW 1 86176825 missense probably damaging 0.97
Z1177:Armc9 UTSW 1 86196355 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCTCTTCGGGTTCTTTC -3'
(R):5'- CTGAATGACTCCCAAGGTATCACAG -3'

Sequencing Primer
(F):5'- CAAGAAGAAAACCATTTCACTGTG -3'
(R):5'- AGGTATCACAGCCGTCCATGAG -3'
Posted On2016-10-06