Mutagenetix > Incidental Mutation

Incidental Mutation 'R5459:Tecpr1'

432923

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

043022-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5459 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 144207416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 656 (Y656F)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000085701
AA Change: Y656F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: Y656F

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153751

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156129

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	C	T	17: 23,711,843		probably benign	Het
2300002M23Rik	A	G	17: 35,568,182	E139G	possibly damaging	Het
4931408C20Rik	A	C	1: 26,685,191	S303A	probably damaging	Het
Abcc6	T	C	7: 45,982,183	N1223S	probably benign	Het
Adamts3	A	T	5: 89,691,473		probably null	Het
Aloxe3	T	A	11: 69,132,828	F259Y	possibly damaging	Het
Armc9	G	A	1: 86,207,972	R550Q	probably damaging	Het
Ctnnd2	A	G	15: 30,887,188	D787G	probably damaging	Het
Dnah7b	A	G	1: 46,109,312	I283V	probably null	Het
Ebf2	A	G	14: 67,235,201	M23V	probably benign	Het
Fbxw11	T	C	11: 32,739,191	V438A	possibly damaging	Het
Fcrla	G	A	1: 170,918,169	T348M	possibly damaging	Het
Gpr179	A	T	11: 97,336,657	H1557Q	probably benign	Het
Gpr87	A	G	3: 59,179,727	V119A	possibly damaging	Het
Hfm1	A	G	5: 106,904,763	S285P	probably damaging	Het
Hs3st5	T	C	10: 36,828,746	V15A	possibly damaging	Het
Hyal5	C	T	6: 24,891,251	H355Y	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Map4k3	T	A	17: 80,609,787	N587Y	probably damaging	Het
Mcm3ap	T	A	10: 76,496,482	L1211*	probably null	Het
Mcmdc2	A	G	1: 9,937,084	I620V	probably benign	Het
Micalcl	C	T	7: 112,382,237	H539Y	probably benign	Het
Myo9a	T	C	9: 59,884,520	L1802P	probably damaging	Het
Neto2	T	A	8: 85,670,483	I47F	probably benign	Het
Olfr1443	A	G	19: 12,680,435	E109G	probably damaging	Het
Oog3	G	A	4: 144,159,245	T261I	probably benign	Het
Pdilt	A	G	7: 119,486,935	L519P	probably benign	Het
Pnpla6	A	T	8: 3,535,829	M844L	probably benign	Het
Polk	C	T	13: 96,495,476	G250R	probably damaging	Het
Rasal2	A	G	1: 157,157,661	S839P	probably damaging	Het
Siae	T	C	9: 37,616,823	Y31H	probably damaging	Het
Slc27a2	T	C	2: 126,580,992	V379A	probably damaging	Het
Snx9	C	T	17: 5,920,638	T418M	probably damaging	Het
Srp72	A	G	5: 76,984,338	T258A	probably benign	Het
Tango6	T	A	8: 106,850,289	D1058E	probably damaging	Het
Tnik	T	A	3: 28,661,741	I1168K	probably damaging	Het
Togaram1	A	G	12: 64,967,736	E587G	probably damaging	Het
Tyw1	A	C	5: 130,274,706	D305A	probably damaging	Het
Vmn1r19	T	A	6: 57,404,490	Y9*	probably null	Het
Zkscan3	A	T	13: 21,394,812	V142E	probably damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- GACTCAAACATGTGACCCCG -3'
(R):5'- AAGAGCTGCCTGTGACCTTTC -3'

Sequencing Primer
(F):5'- CATCCTAGGCTACATGGTGAGTC -3'
(R):5'- GCCTGTGACCTTTCCCCTCTG -3'

Posted On

2016-10-06