Incidental Mutation 'R5459:Tecpr1'
ID432923
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144207416 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 656 (Y656F)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
Predicted Effect probably damaging
Transcript: ENSMUST00000085701
AA Change: Y656F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: Y656F

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156129
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
PIT4531001:Tecpr1 UTSW 5 144214067 missense probably damaging 0.96
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1597:Tecpr1 UTSW 5 144214310 missense probably benign 0.00
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 splice site probably null
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
R7276:Tecpr1 UTSW 5 144217020 nonsense probably null
R7314:Tecpr1 UTSW 5 144217332 missense probably damaging 1.00
R7375:Tecpr1 UTSW 5 144208599 missense possibly damaging 0.68
R7632:Tecpr1 UTSW 5 144218726 missense probably benign 0.03
R7702:Tecpr1 UTSW 5 144203418 missense probably damaging 1.00
R8135:Tecpr1 UTSW 5 144198602 missense probably damaging 0.99
R8406:Tecpr1 UTSW 5 144200840 missense probably damaging 1.00
R8844:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8856:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8857:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
R8866:Tecpr1 UTSW 5 144216299 missense possibly damaging 0.94
RF001:Tecpr1 UTSW 5 144217386 missense probably damaging 0.99
Z1176:Tecpr1 UTSW 5 144218591 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GACTCAAACATGTGACCCCG -3'
(R):5'- AAGAGCTGCCTGTGACCTTTC -3'

Sequencing Primer
(F):5'- CATCCTAGGCTACATGGTGAGTC -3'
(R):5'- GCCTGTGACCTTTCCCCTCTG -3'
Posted On2016-10-06