Incidental Mutation 'R5459:Hyal5'
ID432924
Institutional Source Beutler Lab
Gene Symbol Hyal5
Ensembl Gene ENSMUSG00000029678
Gene Namehyaluronoglucosaminidase 5
Synonyms
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location24857997-24891958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24891251 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 355 (H355Y)
Ref Sequence ENSEMBL: ENSMUSP00000144011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031689] [ENSMUST00000200968]
Predicted Effect probably damaging
Transcript: ENSMUST00000031689
AA Change: H355Y

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031689
Gene: ENSMUSG00000029678
AA Change: H355Y

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104008
Predicted Effect probably damaging
Transcript: ENSMUST00000200968
AA Change: H355Y

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144011
Gene: ENSMUSG00000029678
AA Change: H355Y

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 2.6e-142 PFAM
Blast:EGF 375 438 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201585
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Reproduction is normal in mice with null mutations at this marker. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Hyal5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Hyal5 APN 6 24876481 missense possibly damaging 0.92
IGL01407:Hyal5 APN 6 24876407 missense probably benign 0.08
IGL01799:Hyal5 APN 6 24891337 missense probably benign 0.09
IGL02070:Hyal5 APN 6 24876962 missense probably damaging 1.00
IGL02087:Hyal5 APN 6 24876725 missense probably damaging 1.00
IGL02188:Hyal5 APN 6 24877036 missense probably damaging 1.00
IGL02321:Hyal5 APN 6 24891615 missense probably benign 0.01
IGL02975:Hyal5 APN 6 24891452 missense probably benign 0.41
IGL03299:Hyal5 APN 6 24877882 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0239:Hyal5 UTSW 6 24876344 missense probably damaging 1.00
R0499:Hyal5 UTSW 6 24877921 missense probably damaging 1.00
R1491:Hyal5 UTSW 6 24877903 missense probably benign 0.00
R1575:Hyal5 UTSW 6 24876793 missense probably damaging 1.00
R1967:Hyal5 UTSW 6 24876194 missense possibly damaging 0.68
R2182:Hyal5 UTSW 6 24877880 missense probably damaging 1.00
R3801:Hyal5 UTSW 6 24876524 missense probably benign 0.44
R3877:Hyal5 UTSW 6 24876631 missense probably damaging 1.00
R4642:Hyal5 UTSW 6 24876622 missense probably benign 0.01
R4826:Hyal5 UTSW 6 24891576 missense possibly damaging 0.82
R5058:Hyal5 UTSW 6 24891485 missense probably damaging 1.00
R5161:Hyal5 UTSW 6 24891603 missense probably benign 0.00
R5249:Hyal5 UTSW 6 24876649 nonsense probably null
R5685:Hyal5 UTSW 6 24876692 missense probably benign 0.39
R5741:Hyal5 UTSW 6 24876495 missense probably damaging 1.00
R5849:Hyal5 UTSW 6 24891556 missense probably benign 0.00
R6156:Hyal5 UTSW 6 24891438 missense possibly damaging 0.92
R6351:Hyal5 UTSW 6 24891709 splice site probably null
R6573:Hyal5 UTSW 6 24891552 missense probably damaging 0.96
R6949:Hyal5 UTSW 6 24876304 missense probably benign 0.00
R6966:Hyal5 UTSW 6 24891292 missense probably damaging 1.00
R7148:Hyal5 UTSW 6 24876902 missense probably damaging 1.00
R7422:Hyal5 UTSW 6 24875984 start gained probably benign
R7836:Hyal5 UTSW 6 24891348 missense probably damaging 1.00
R8062:Hyal5 UTSW 6 24876197 missense possibly damaging 0.73
R8127:Hyal5 UTSW 6 24891488 missense probably benign 0.05
R8220:Hyal5 UTSW 6 24876880 missense probably benign 0.00
X0061:Hyal5 UTSW 6 24876973 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTTCAAAGCCAAATCGAGTCTC -3'
(R):5'- GGGATTGCCACGGATTTCATAC -3'

Sequencing Primer
(F):5'- TCACCACCATGAAATGGC -3'
(R):5'- GGATTGCCACGGATTTCATACTTTCC -3'
Posted On2016-10-06