Mutagenetix > Incidental Mutations

Incidental Mutation 'R5459:Abcc6'

432927

Institutional Source

Beutler Lab

Gene Symbol

Abcc6

Ensembl Gene

ENSMUSG00000030834

Gene Name

ATP-binding cassette, sub-family C (CFTR/MRP), member 6

Synonyms

Mrp6, DCC, Dyscalc1

MMRRC Submission

043022-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.779) question?

Stock #

R5459 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45967555-46030302 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45982183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1223 (N1223S)

Ref Sequence

ENSEMBL: ENSMUSP00000002850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002850]

AlphaFold

Q9R1S7

Predicted Effect

probably benign
Transcript: ENSMUST00000002850
AA Change: N1223S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: N1223S

Domain	Start	End	E-Value	Type
transmembrane domain	44	61	N/A	INTRINSIC
transmembrane domain	81	100	N/A	INTRINSIC
transmembrane domain	110	129	N/A	INTRINSIC
transmembrane domain	142	161	N/A	INTRINSIC
transmembrane domain	171	193	N/A	INTRINSIC
Pfam:ABC_membrane	309	580	3.5e-29	PFAM
AAA	653	828	1.19e-9	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:ABC_membrane	942	1211	2.5e-32	PFAM
AAA	1286	1473	1.71e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209985

Predicted Effect

probably benign
Transcript: ENSMUST00000211220

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1520401A03Rik	C	T	17: 23,711,843		probably benign	Het
2300002M23Rik	A	G	17: 35,568,182	E139G	possibly damaging	Het
4931408C20Rik	A	C	1: 26,685,191	S303A	probably damaging	Het
Adamts3	A	T	5: 89,691,473		probably null	Het
Aloxe3	T	A	11: 69,132,828	F259Y	possibly damaging	Het
Armc9	G	A	1: 86,207,972	R550Q	probably damaging	Het
Ctnnd2	A	G	15: 30,887,188	D787G	probably damaging	Het
Dnah7b	A	G	1: 46,109,312	I283V	probably null	Het
Ebf2	A	G	14: 67,235,201	M23V	probably benign	Het
Fbxw11	T	C	11: 32,739,191	V438A	possibly damaging	Het
Fcrla	G	A	1: 170,918,169	T348M	possibly damaging	Het
Gpr179	A	T	11: 97,336,657	H1557Q	probably benign	Het
Gpr87	A	G	3: 59,179,727	V119A	possibly damaging	Het
Hfm1	A	G	5: 106,904,763	S285P	probably damaging	Het
Hs3st5	T	C	10: 36,828,746	V15A	possibly damaging	Het
Hyal5	C	T	6: 24,891,251	H355Y	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Map4k3	T	A	17: 80,609,787	N587Y	probably damaging	Het
Mcm3ap	T	A	10: 76,496,482	L1211*	probably null	Het
Mcmdc2	A	G	1: 9,937,084	I620V	probably benign	Het
Micalcl	C	T	7: 112,382,237	H539Y	probably benign	Het
Myo9a	T	C	9: 59,884,520	L1802P	probably damaging	Het
Neto2	T	A	8: 85,670,483	I47F	probably benign	Het
Olfr1443	A	G	19: 12,680,435	E109G	probably damaging	Het
Oog3	G	A	4: 144,159,245	T261I	probably benign	Het
Pdilt	A	G	7: 119,486,935	L519P	probably benign	Het
Pnpla6	A	T	8: 3,535,829	M844L	probably benign	Het
Polk	C	T	13: 96,495,476	G250R	probably damaging	Het
Rasal2	A	G	1: 157,157,661	S839P	probably damaging	Het
Siae	T	C	9: 37,616,823	Y31H	probably damaging	Het
Slc27a2	T	C	2: 126,580,992	V379A	probably damaging	Het
Snx9	C	T	17: 5,920,638	T418M	probably damaging	Het
Srp72	A	G	5: 76,984,338	T258A	probably benign	Het
Tango6	T	A	8: 106,850,289	D1058E	probably damaging	Het
Tecpr1	T	A	5: 144,207,416	Y656F	probably damaging	Het
Tnik	T	A	3: 28,661,741	I1168K	probably damaging	Het
Togaram1	A	G	12: 64,967,736	E587G	probably damaging	Het
Tyw1	A	C	5: 130,274,706	D305A	probably damaging	Het
Vmn1r19	T	A	6: 57,404,490	Y9*	probably null	Het
Zkscan3	A	T	13: 21,394,812	V142E	probably damaging	Het

Other mutations in Abcc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01589:Abcc6	APN	7	46002672	splice site	probably benign
IGL01731:Abcc6	APN	7	46002610	missense	possibly damaging	0.71
IGL01743:Abcc6	APN	7	45996814	missense	probably benign	0.02
IGL01757:Abcc6	APN	7	45990281	splice site	probably benign
IGL01895:Abcc6	APN	7	46029058	missense	possibly damaging	0.88
IGL01942:Abcc6	APN	7	45986573	missense	possibly damaging	0.89
IGL02251:Abcc6	APN	7	45977416	missense	probably damaging	1.00
IGL02277:Abcc6	APN	7	46001061	missense	probably benign	0.00
IGL02548:Abcc6	APN	7	46005262	missense	probably damaging	0.98
IGL03063:Abcc6	APN	7	46016432	missense	probably benign
IGL03092:Abcc6	APN	7	45986470	missense	probably damaging	1.00
IGL03251:Abcc6	APN	7	45982237	unclassified	probably benign
R0057:Abcc6	UTSW	7	46020143	missense	probably benign	0.03
R0944:Abcc6	UTSW	7	46015505	missense	possibly damaging	0.81
R1019:Abcc6	UTSW	7	46014107	missense	possibly damaging	0.77
R1183:Abcc6	UTSW	7	45985253	missense	probably damaging	0.99
R1543:Abcc6	UTSW	7	46016504	missense	probably benign	0.01
R1550:Abcc6	UTSW	7	46005244	missense	probably benign	0.25
R1725:Abcc6	UTSW	7	45992357	missense	possibly damaging	0.76
R1907:Abcc6	UTSW	7	46014169	missense	probably benign	0.04
R1908:Abcc6	UTSW	7	46020134	splice site	probably null
R1909:Abcc6	UTSW	7	46020134	splice site	probably null
R2138:Abcc6	UTSW	7	45981051	missense	probably damaging	1.00
R2145:Abcc6	UTSW	7	45998741	missense	probably benign	0.01
R2402:Abcc6	UTSW	7	46015575	missense	probably benign	0.04
R3983:Abcc6	UTSW	7	45995289	missense	probably benign
R4013:Abcc6	UTSW	7	46018680	missense	probably benign	0.01
R4051:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4052:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4208:Abcc6	UTSW	7	45986563	missense	probably damaging	1.00
R4362:Abcc6	UTSW	7	45998832	splice site	probably benign
R4385:Abcc6	UTSW	7	45995328	missense	possibly damaging	0.93
R4399:Abcc6	UTSW	7	46002607	missense	probably benign
R4479:Abcc6	UTSW	7	46005239	missense	possibly damaging	0.60
R4480:Abcc6	UTSW	7	46005239	missense	possibly damaging	0.60
R4780:Abcc6	UTSW	7	45996691	missense	probably benign
R4791:Abcc6	UTSW	7	45982160	missense	probably benign	0.00
R4895:Abcc6	UTSW	7	45980990	missense	possibly damaging	0.95
R4898:Abcc6	UTSW	7	45989687	missense	probably damaging	0.96
R4905:Abcc6	UTSW	7	45995225	missense	probably benign
R4941:Abcc6	UTSW	7	46012523	missense	probably benign	0.00
R5040:Abcc6	UTSW	7	46020154	missense	probably benign	0.04
R5128:Abcc6	UTSW	7	45989646	missense	probably benign	0.00
R5284:Abcc6	UTSW	7	45981059	missense	probably benign	0.05
R5328:Abcc6	UTSW	7	45992311	missense	probably benign	0.01
R5543:Abcc6	UTSW	7	45989536	critical splice donor site	probably null
R6178:Abcc6	UTSW	7	46029044	missense	probably benign
R6228:Abcc6	UTSW	7	46030256	missense	probably benign	0.02
R6532:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R6605:Abcc6	UTSW	7	45981057	missense	probably damaging	1.00
R7000:Abcc6	UTSW	7	46005522	missense	possibly damaging	0.60
R7067:Abcc6	UTSW	7	46018690	missense	probably benign
R7553:Abcc6	UTSW	7	45999121	missense	probably damaging	1.00
R7597:Abcc6	UTSW	7	45995237	missense	probably damaging	1.00
R7718:Abcc6	UTSW	7	45977392	missense	possibly damaging	0.91
R7781:Abcc6	UTSW	7	46005606	missense	probably damaging	1.00
R7798:Abcc6	UTSW	7	45976853	nonsense	probably null
R7896:Abcc6	UTSW	7	45977379	missense	probably damaging	1.00
R8098:Abcc6	UTSW	7	45996665	missense	probably damaging	1.00
R8443:Abcc6	UTSW	7	45980025	missense	probably damaging	1.00
R8773:Abcc6	UTSW	7	45985145	missense	probably benign
R8784:Abcc6	UTSW	7	46002601	missense	probably benign
R8802:Abcc6	UTSW	7	46008859	missense	probably damaging	0.99
R8807:Abcc6	UTSW	7	45999007	missense	possibly damaging	0.67
R9006:Abcc6	UTSW	7	46016396	missense	probably benign	0.00
R9127:Abcc6	UTSW	7	45979760	missense	probably damaging	1.00
R9475:Abcc6	UTSW	7	46016468	missense	probably damaging	1.00
X0065:Abcc6	UTSW	7	46020197	missense	probably damaging	0.99
Z1176:Abcc6	UTSW	7	45979734	missense	probably damaging	1.00
Z1176:Abcc6	UTSW	7	45992306	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCACTATTGCTGCCACAATGG -3'
(R):5'- TGAGAGAGTCACCTGCTTGCTC -3'

Sequencing Primer
(F):5'- ACAATGGCTGTGACTCCAG -3'
(R):5'- ATGCACTGTCTTATTAGCCAAGC -3'

Posted On

2016-10-06