Incidental Mutation 'R5459:Hs3st5'
ID432935
Institutional Source Beutler Lab
Gene Symbol Hs3st5
Ensembl Gene ENSMUSG00000044499
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 5
SynonymsLOC382362, D930005L05Rik
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location36506814-36834397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36828746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 15 (V15A)
Ref Sequence ENSEMBL: ENSMUSP00000129434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058738] [ENSMUST00000167191] [ENSMUST00000168572]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058738
AA Change: V15A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060229
Gene: ENSMUSG00000044499
AA Change: V15A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167191
AA Change: V15A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130778
Gene: ENSMUSG00000044499
AA Change: V15A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168572
AA Change: V15A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129434
Gene: ENSMUSG00000044499
AA Change: V15A

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HS3ST5 belongs to a group of heparan sulfate 3-O-sulfotransferases (EC 2.8.2.23) that transfer sulfate from 3-prime-phosphoadenosine 5-prime phosphosulfate (PAPS) to heparan sulfate and heparin (Mochizuki et al., 2003 [PubMed 12740361]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Hs3st5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Hs3st5 APN 10 36832922 missense probably benign 0.02
IGL00913:Hs3st5 APN 10 36832850 missense probably damaging 1.00
IGL01407:Hs3st5 APN 10 36833408 missense probably damaging 1.00
IGL01516:Hs3st5 APN 10 36833051 missense probably damaging 1.00
IGL02396:Hs3st5 APN 10 36828703 start codon destroyed probably benign 0.08
IGL03351:Hs3st5 APN 10 36833323 missense probably damaging 1.00
R0606:Hs3st5 UTSW 10 36832588 missense probably benign 0.00
R1412:Hs3st5 UTSW 10 36832676 missense probably benign 0.02
R1443:Hs3st5 UTSW 10 36833414 missense probably benign 0.35
R1493:Hs3st5 UTSW 10 36832874 missense probably damaging 1.00
R1768:Hs3st5 UTSW 10 36833169 missense probably benign 0.01
R1792:Hs3st5 UTSW 10 36832724 missense probably benign
R1991:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R1992:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R4330:Hs3st5 UTSW 10 36832730 missense probably benign 0.06
R4610:Hs3st5 UTSW 10 36828806 missense probably benign 0.26
R5561:Hs3st5 UTSW 10 36833429 missense probably damaging 1.00
R6005:Hs3st5 UTSW 10 36832928 missense probably damaging 1.00
R7082:Hs3st5 UTSW 10 36832837 missense probably benign 0.01
R7326:Hs3st5 UTSW 10 36833194 missense probably damaging 1.00
R7507:Hs3st5 UTSW 10 36833015 missense probably damaging 1.00
R7885:Hs3st5 UTSW 10 36828780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATACCGCCAAAGTTTCAGTGTG -3'
(R):5'- AGCAGTGTGAAGCATGTTTCTTC -3'

Sequencing Primer
(F):5'- GATCTCATTGCAAAGTGGCC -3'
(R):5'- GTGAAGCATGTTTCTTCTATAAGGTC -3'
Posted On2016-10-06