Incidental Mutation 'R5459:Snx9'
ID432946
Institutional Source Beutler Lab
Gene Symbol Snx9
Ensembl Gene ENSMUSG00000002365
Gene Namesorting nexin 9
SynonymsSH3PX1, SDP1
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location5841329-5931954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5920638 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 418 (T418M)
Ref Sequence ENSEMBL: ENSMUSP00000002436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002436]
PDB Structure
Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000002436
AA Change: T418M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: T418M

DomainStartEndE-ValueType
SH3 3 61 1.51e-16 SMART
low complexity region 84 100 N/A INTRINSIC
low complexity region 160 170 N/A INTRINSIC
PX 247 357 4.15e-23 SMART
Pfam:BAR_3_WASP_bdg 358 593 2.4e-120 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Snx9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Snx9 APN 17 5899361 missense probably benign
IGL00417:Snx9 APN 17 5891897 missense probably benign 0.03
IGL01827:Snx9 APN 17 5887012 missense probably benign 0.04
IGL02531:Snx9 APN 17 5891820 missense probably benign
IGL02710:Snx9 APN 17 5908598 missense probably damaging 1.00
IGL03088:Snx9 APN 17 5924610 missense probably benign
san_angelo UTSW 17 5891809 nonsense probably null
PIT4495001:Snx9 UTSW 17 5920126 missense possibly damaging 0.54
R0555:Snx9 UTSW 17 5918413 missense probably damaging 0.97
R1015:Snx9 UTSW 17 5920127 missense probably benign 0.12
R1065:Snx9 UTSW 17 5902361 splice site probably benign
R1421:Snx9 UTSW 17 5902484 missense probably benign 0.45
R1657:Snx9 UTSW 17 5918436 missense possibly damaging 0.65
R1823:Snx9 UTSW 17 5920671 missense probably damaging 1.00
R1914:Snx9 UTSW 17 5928256 missense possibly damaging 0.65
R3703:Snx9 UTSW 17 5928200 splice site probably null
R3871:Snx9 UTSW 17 5891781 missense probably benign 0.00
R4375:Snx9 UTSW 17 5908626 nonsense probably null
R4412:Snx9 UTSW 17 5908394 missense probably damaging 0.96
R4669:Snx9 UTSW 17 5927224 missense probably damaging 1.00
R4974:Snx9 UTSW 17 5902519 splice site probably null
R5038:Snx9 UTSW 17 5887073 missense probably benign 0.12
R5137:Snx9 UTSW 17 5928253 missense probably damaging 1.00
R5369:Snx9 UTSW 17 5920580 missense probably damaging 1.00
R5624:Snx9 UTSW 17 5891809 nonsense probably null
R5847:Snx9 UTSW 17 5924621 missense possibly damaging 0.94
R5953:Snx9 UTSW 17 5908402 missense probably damaging 1.00
R5953:Snx9 UTSW 17 5908403 missense probably damaging 1.00
R6263:Snx9 UTSW 17 5887049 missense probably damaging 0.98
R6481:Snx9 UTSW 17 5922209 critical splice donor site probably null
R6491:Snx9 UTSW 17 5920162 missense probably benign 0.00
R7873:Snx9 UTSW 17 5918476 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCCTTGGAATCAAACCCATGGC -3'
(R):5'- AGCATGGACTATACAGACCCTTC -3'

Sequencing Primer
(F):5'- CCTGGAGCTTGCAGACATTG -3'
(R):5'- GCAAGAAGTACCCTCTAAGTATGCAG -3'
Posted On2016-10-06