Incidental Mutation 'R5459:Map4k3'
ID432948
Institutional Source Beutler Lab
Gene Symbol Map4k3
Ensembl Gene ENSMUSG00000024242
Gene Namemitogen-activated protein kinase kinase kinase kinase 3
Synonyms
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location80580512-80728093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80609787 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 587 (N587Y)
Ref Sequence ENSEMBL: ENSMUSP00000108008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025089] [ENSMUST00000112389]
Predicted Effect probably damaging
Transcript: ENSMUST00000025089
AA Change: N587Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025089
Gene: ENSMUSG00000024242
AA Change: N587Y

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 874 2e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112389
AA Change: N587Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108008
Gene: ENSMUSG00000024242
AA Change: N587Y

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 876 1.39e-114 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C T 17: 23,711,843 probably benign Het
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in Map4k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Map4k3 APN 17 80636718 critical splice donor site probably null
IGL01329:Map4k3 APN 17 80644184 missense probably benign
IGL01626:Map4k3 APN 17 80605809 missense probably damaging 0.97
IGL01896:Map4k3 APN 17 80613931 missense probably benign 0.13
IGL02021:Map4k3 APN 17 80609826 missense probably damaging 1.00
IGL02585:Map4k3 APN 17 80653919 splice site probably benign
IGL03101:Map4k3 APN 17 80655855 critical splice donor site probably null
IGL03231:Map4k3 APN 17 80597675 missense probably damaging 1.00
IGL03267:Map4k3 APN 17 80664028 missense probably damaging 1.00
maple_forest UTSW 17 80603998 missense probably benign 0.38
R0084:Map4k3 UTSW 17 80655914 missense possibly damaging 0.91
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0612:Map4k3 UTSW 17 80602193 missense probably damaging 1.00
R0842:Map4k3 UTSW 17 80605983 missense probably benign 0.35
R2009:Map4k3 UTSW 17 80664088 splice site probably benign
R2224:Map4k3 UTSW 17 80630454 missense probably benign 0.00
R3851:Map4k3 UTSW 17 80644323 splice site probably benign
R4049:Map4k3 UTSW 17 80605965 missense probably benign 0.10
R4151:Map4k3 UTSW 17 80644534 missense probably damaging 1.00
R4345:Map4k3 UTSW 17 80597551 critical splice donor site probably null
R4405:Map4k3 UTSW 17 80615015 critical splice donor site probably null
R4450:Map4k3 UTSW 17 80603982 critical splice donor site probably null
R4970:Map4k3 UTSW 17 80653903 missense probably benign 0.00
R5230:Map4k3 UTSW 17 80615170 missense probably benign 0.00
R5568:Map4k3 UTSW 17 80663998 missense possibly damaging 0.96
R5635:Map4k3 UTSW 17 80613495 missense possibly damaging 0.94
R5827:Map4k3 UTSW 17 80593283 critical splice donor site probably null
R5927:Map4k3 UTSW 17 80613919 missense probably benign 0.06
R5951:Map4k3 UTSW 17 80603998 missense probably benign 0.38
R5964:Map4k3 UTSW 17 80644762 missense probably damaging 1.00
R6849:Map4k3 UTSW 17 80630413 critical splice donor site probably null
R6985:Map4k3 UTSW 17 80636732 missense probably damaging 1.00
R7040:Map4k3 UTSW 17 80680915 missense probably damaging 0.98
R7233:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7511:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7672:Map4k3 UTSW 17 80615071 missense possibly damaging 0.58
R7680:Map4k3 UTSW 17 80581876 missense probably benign 0.02
R7804:Map4k3 UTSW 17 80615070 missense probably damaging 0.98
X0023:Map4k3 UTSW 17 80593091 missense probably benign
Z1176:Map4k3 UTSW 17 80618337 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTGTGGCCTTCTTCAGTATG -3'
(R):5'- CCTCCTCACTGCTCTGAGAATAAC -3'

Sequencing Primer
(F):5'- GCCTTCTTCAGTATGTAGCAAATGG -3'
(R):5'- AGGTTATGAGGGTCTAATTCCAC -3'
Posted On2016-10-06