Incidental Mutation 'R5460:Adamtsl2'
ID432950
Institutional Source Beutler Lab
Gene Symbol Adamtsl2
Ensembl Gene ENSMUSG00000036040
Gene NameADAMTS-like 2
SynonymsA930008K15Rik
MMRRC Submission 042849-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5460 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location27079379-27108981 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 27095398 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091233]
Predicted Effect probably null
Transcript: ENSMUST00000091233
SMART Domains Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSP1 50 106 5.14e-7 SMART
Pfam:ADAM_spacer1 214 331 5.4e-28 PFAM
low complexity region 345 358 N/A INTRINSIC
TSP1 573 629 8.15e-1 SMART
TSP1 631 692 1.85e-2 SMART
TSP1 694 744 4.15e-1 SMART
TSP1 747 796 9.98e-5 SMART
TSP1 803 861 4.95e-2 SMART
TSP1 863 914 2.53e-6 SMART
Pfam:PLAC 922 953 1.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169787
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,865 K94R probably benign Het
9530077C05Rik T C 9: 22,439,920 F453L probably benign Het
9930021J03Rik G T 19: 29,754,850 P254Q probably damaging Het
Actbl2 T A 13: 111,255,704 M191K probably benign Het
Actn1 T C 12: 80,183,568 N304S probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 T C 13: 81,424,258 E4928G possibly damaging Het
Alms1 T A 6: 85,696,731 C3103S probably benign Het
Appl2 T A 10: 83,602,832 I578F probably benign Het
Atp10b T C 11: 43,230,455 S982P probably benign Het
Capn7 T C 14: 31,368,203 probably null Het
Cd200r3 A G 16: 44,957,730 T166A possibly damaging Het
Dctn6 C T 8: 34,104,981 probably null Het
Fam114a1 T A 5: 65,028,433 F366I probably damaging Het
Fam98b A T 2: 117,259,256 S85C probably damaging Het
Fat3 T A 9: 15,919,167 N4344Y probably damaging Het
Fhl3 T G 4: 124,706,003 C92W probably damaging Het
Flrt1 T C 19: 7,095,740 T481A probably damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gm4981 G A 10: 58,235,895 H166Y possibly damaging Het
Gng2 G T 14: 19,891,358 N5K probably benign Het
Iqcm A T 8: 75,714,789 D230V probably benign Het
Limk2 T C 11: 3,352,332 I176V probably benign Het
Lrrk2 T A 15: 91,814,644 probably null Het
Maml1 T C 11: 50,266,353 T332A probably benign Het
Mbd1 T C 18: 74,269,510 F28L probably benign Het
Morf4l1 G A 9: 90,095,130 T246I probably benign Het
Ndufaf1 T G 2: 119,660,477 D34A probably benign Het
Olfr1219 C T 2: 89,074,864 V76I probably benign Het
Olfr1250 T A 2: 89,657,070 I124F probably damaging Het
Patl1 C T 19: 11,935,718 R542C possibly damaging Het
Pcdha2 T C 18: 36,939,421 V35A probably damaging Het
Phf11b G A 14: 59,331,264 P67S probably benign Het
Plxnd1 T C 6: 115,957,648 I1775V probably damaging Het
Ryr1 T A 7: 29,071,961 T2552S probably damaging Het
Scai A T 2: 39,083,573 L52H probably damaging Het
Scai G C 2: 39,083,574 L52V probably damaging Het
Stag1 A T 9: 100,956,453 probably null Het
Tgs1 A G 4: 3,586,170 K349R probably benign Het
Tpbgl T C 7: 99,625,754 I299V probably benign Het
Ttc3 A G 16: 94,457,382 T1325A probably benign Het
Ubxn11 A T 4: 134,125,085 E210D probably damaging Het
Unc13c T C 9: 73,545,989 I1840V probably benign Het
Zfp74 A T 7: 29,935,891 F131I probably benign Het
Other mutations in Adamtsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Adamtsl2 APN 2 27085088 missense probably damaging 1.00
IGL01902:Adamtsl2 APN 2 27087252 missense probably damaging 1.00
IGL02207:Adamtsl2 APN 2 27102981 missense probably damaging 0.99
IGL02247:Adamtsl2 APN 2 27084893 missense probably damaging 1.00
IGL02253:Adamtsl2 APN 2 27098697 missense possibly damaging 0.48
IGL02655:Adamtsl2 APN 2 27082530 splice site probably benign
IGL03148:Adamtsl2 APN 2 27084059 missense probably damaging 0.99
IGL03269:Adamtsl2 APN 2 27108355 nonsense probably null
R0609:Adamtsl2 UTSW 2 27089635 missense probably benign 0.25
R1183:Adamtsl2 UTSW 2 27084080 missense probably damaging 1.00
R1443:Adamtsl2 UTSW 2 27103066 missense possibly damaging 0.89
R1675:Adamtsl2 UTSW 2 27082485 frame shift probably null
R1698:Adamtsl2 UTSW 2 27103127 missense possibly damaging 0.92
R1765:Adamtsl2 UTSW 2 27102830 missense probably benign 0.01
R1934:Adamtsl2 UTSW 2 27089593 missense probably damaging 0.99
R2106:Adamtsl2 UTSW 2 27102825 missense probably benign 0.02
R2108:Adamtsl2 UTSW 2 27095558 missense probably benign
R2189:Adamtsl2 UTSW 2 27081738 missense probably benign 0.00
R2232:Adamtsl2 UTSW 2 27103178 missense probably damaging 1.00
R4301:Adamtsl2 UTSW 2 27087283 missense probably null 1.00
R4518:Adamtsl2 UTSW 2 27095547 missense probably benign 0.00
R4572:Adamtsl2 UTSW 2 27083256 missense probably damaging 0.99
R4627:Adamtsl2 UTSW 2 27093585 missense probably damaging 0.99
R4668:Adamtsl2 UTSW 2 27095475 missense probably benign 0.00
R4686:Adamtsl2 UTSW 2 27093825 missense probably damaging 0.99
R4821:Adamtsl2 UTSW 2 27098592 splice site probably null
R5054:Adamtsl2 UTSW 2 27101720 missense probably damaging 1.00
R5569:Adamtsl2 UTSW 2 27102833 missense probably damaging 1.00
R5694:Adamtsl2 UTSW 2 27081724 missense probably benign 0.03
R6836:Adamtsl2 UTSW 2 27081706 start codon destroyed probably null 0.90
R7103:Adamtsl2 UTSW 2 27107461 missense probably damaging 1.00
R7437:Adamtsl2 UTSW 2 27089709 missense probably damaging 0.99
X0003:Adamtsl2 UTSW 2 27081772 small deletion probably benign
X0003:Adamtsl2 UTSW 2 27081773 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAGTGATCATTGGGTTTCC -3'
(R):5'- TCCACATAGAGGCTCTCAGC -3'

Sequencing Primer
(F):5'- ATCATTGGGTTTCCTATCATTCGATG -3'
(R):5'- ATAGAGGCTCTCAGCTGGGG -3'
Posted On2016-10-06