Mutagenetix > Incidental Mutation

Incidental Mutation 'R5460:Adamtsl2'

432950

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

042849-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5460 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 27095398 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably null
Transcript: ENSMUST00000091233

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	T	C	10: 43,532,865	K94R	probably benign	Het
9530077C05Rik	T	C	9: 22,439,920	F453L	probably benign	Het
9930021J03Rik	G	T	19: 29,754,850	P254Q	probably damaging	Het
Actbl2	T	A	13: 111,255,704	M191K	probably benign	Het
Actn1	T	C	12: 80,183,568	N304S	probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	T	C	13: 81,424,258	E4928G	possibly damaging	Het
Alms1	T	A	6: 85,696,731	C3103S	probably benign	Het
Appl2	T	A	10: 83,602,832	I578F	probably benign	Het
Atp10b	T	C	11: 43,230,455	S982P	probably benign	Het
Capn7	T	C	14: 31,368,203		probably null	Het
Cd200r3	A	G	16: 44,957,730	T166A	possibly damaging	Het
Dctn6	C	T	8: 34,104,981		probably null	Het
Fam114a1	T	A	5: 65,028,433	F366I	probably damaging	Het
Fam98b	A	T	2: 117,259,256	S85C	probably damaging	Het
Fat3	T	A	9: 15,919,167	N4344Y	probably damaging	Het
Fhl3	T	G	4: 124,706,003	C92W	probably damaging	Het
Flrt1	T	C	19: 7,095,740	T481A	probably damaging	Het
Gm16286	C	T	18: 80,211,923	A144V	probably damaging	Het
Gm4981	G	A	10: 58,235,895	H166Y	possibly damaging	Het
Gng2	G	T	14: 19,891,358	N5K	probably benign	Het
Iqcm	A	T	8: 75,714,789	D230V	probably benign	Het
Limk2	T	C	11: 3,352,332	I176V	probably benign	Het
Lrrk2	T	A	15: 91,814,644		probably null	Het
Maml1	T	C	11: 50,266,353	T332A	probably benign	Het
Mbd1	T	C	18: 74,269,510	F28L	probably benign	Het
Morf4l1	G	A	9: 90,095,130	T246I	probably benign	Het
Ndufaf1	T	G	2: 119,660,477	D34A	probably benign	Het
Olfr1219	C	T	2: 89,074,864	V76I	probably benign	Het
Olfr1250	T	A	2: 89,657,070	I124F	probably damaging	Het
Patl1	C	T	19: 11,935,718	R542C	possibly damaging	Het
Pcdha2	T	C	18: 36,939,421	V35A	probably damaging	Het
Phf11b	G	A	14: 59,331,264	P67S	probably benign	Het
Plxnd1	T	C	6: 115,957,648	I1775V	probably damaging	Het
Ryr1	T	A	7: 29,071,961	T2552S	probably damaging	Het
Scai	A	T	2: 39,083,573	L52H	probably damaging	Het
Scai	G	C	2: 39,083,574	L52V	probably damaging	Het
Stag1	A	T	9: 100,956,453		probably null	Het
Tgs1	A	G	4: 3,586,170	K349R	probably benign	Het
Tpbgl	T	C	7: 99,625,754	I299V	probably benign	Het
Ttc3	A	G	16: 94,457,382	T1325A	probably benign	Het
Ubxn11	A	T	4: 134,125,085	E210D	probably damaging	Het
Unc13c	T	C	9: 73,545,989	I1840V	probably benign	Het
Zfp74	A	T	7: 29,935,891	F131I	probably benign	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
R9284:Adamtsl2	UTSW	2	27104043	splice site	probably benign
R9566:Adamtsl2	UTSW	2	27089761	critical splice donor site	probably null
R9772:Adamtsl2	UTSW	2	27095654	missense	probably benign
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTGCAGTGATCATTGGGTTTCC -3'
(R):5'- TCCACATAGAGGCTCTCAGC -3'

Sequencing Primer
(F):5'- ATCATTGGGTTTCCTATCATTCGATG -3'
(R):5'- ATAGAGGCTCTCAGCTGGGG -3'

Posted On

2016-10-06