Incidental Mutation 'R5460:Scai'
ID432951
Institutional Source Beutler Lab
Gene Symbol Scai
Ensembl Gene ENSMUSG00000035236
Gene Namesuppressor of cancer cell invasion
SynonymsA930041I02Rik
MMRRC Submission 042849-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.595) question?
Stock #R5460 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location39066214-39190734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39083573 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 52 (L52H)
Ref Sequence ENSEMBL: ENSMUSP00000144844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038874] [ENSMUST00000147433] [ENSMUST00000204093] [ENSMUST00000204404] [ENSMUST00000204500]
Predicted Effect probably damaging
Transcript: ENSMUST00000038874
AA Change: L455H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037194
Gene: ENSMUSG00000035236
AA Change: L455H

DomainStartEndE-ValueType
Pfam:DUF3550 64 557 6.1e-216 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147433
Predicted Effect probably damaging
Transcript: ENSMUST00000204093
AA Change: L455H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145133
Gene: ENSMUSG00000035236
AA Change: L455H

DomainStartEndE-ValueType
Pfam:DUF3550 64 480 2.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204404
Predicted Effect probably damaging
Transcript: ENSMUST00000204500
AA Change: L52H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144844
Gene: ENSMUSG00000035236
AA Change: L52H

DomainStartEndE-ValueType
Pfam:DUF3550 1 77 3.2e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cell migration. The encoded protein appears to function in the RhoA (ras homolog gene family, member A)-Dia1 (diaphanous homolog 1) signal transduction pathway. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice of both sexes are sub-fertile owing to compromised meiotic synapsis and homologous recombination-mediated double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,865 K94R probably benign Het
9530077C05Rik T C 9: 22,439,920 F453L probably benign Het
9930021J03Rik G T 19: 29,754,850 P254Q probably damaging Het
Actbl2 T A 13: 111,255,704 M191K probably benign Het
Actn1 T C 12: 80,183,568 N304S probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamtsl2 T A 2: 27,095,398 probably null Het
Adgrv1 T C 13: 81,424,258 E4928G possibly damaging Het
Alms1 T A 6: 85,696,731 C3103S probably benign Het
Appl2 T A 10: 83,602,832 I578F probably benign Het
Atp10b T C 11: 43,230,455 S982P probably benign Het
Capn7 T C 14: 31,368,203 probably null Het
Cd200r3 A G 16: 44,957,730 T166A possibly damaging Het
Dctn6 C T 8: 34,104,981 probably null Het
Fam114a1 T A 5: 65,028,433 F366I probably damaging Het
Fam98b A T 2: 117,259,256 S85C probably damaging Het
Fat3 T A 9: 15,919,167 N4344Y probably damaging Het
Fhl3 T G 4: 124,706,003 C92W probably damaging Het
Flrt1 T C 19: 7,095,740 T481A probably damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gm4981 G A 10: 58,235,895 H166Y possibly damaging Het
Gng2 G T 14: 19,891,358 N5K probably benign Het
Iqcm A T 8: 75,714,789 D230V probably benign Het
Limk2 T C 11: 3,352,332 I176V probably benign Het
Lrrk2 T A 15: 91,814,644 probably null Het
Maml1 T C 11: 50,266,353 T332A probably benign Het
Mbd1 T C 18: 74,269,510 F28L probably benign Het
Morf4l1 G A 9: 90,095,130 T246I probably benign Het
Ndufaf1 T G 2: 119,660,477 D34A probably benign Het
Olfr1219 C T 2: 89,074,864 V76I probably benign Het
Olfr1250 T A 2: 89,657,070 I124F probably damaging Het
Patl1 C T 19: 11,935,718 R542C possibly damaging Het
Pcdha2 T C 18: 36,939,421 V35A probably damaging Het
Phf11b G A 14: 59,331,264 P67S probably benign Het
Plxnd1 T C 6: 115,957,648 I1775V probably damaging Het
Ryr1 T A 7: 29,071,961 T2552S probably damaging Het
Stag1 A T 9: 100,956,453 probably null Het
Tgs1 A G 4: 3,586,170 K349R probably benign Het
Tpbgl T C 7: 99,625,754 I299V probably benign Het
Ttc3 A G 16: 94,457,382 T1325A probably benign Het
Ubxn11 A T 4: 134,125,085 E210D probably damaging Het
Unc13c T C 9: 73,545,989 I1840V probably benign Het
Zfp74 A T 7: 29,935,891 F131I probably benign Het
Other mutations in Scai
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Scai APN 2 39108394 missense probably damaging 1.00
IGL01366:Scai APN 2 39106961 missense probably benign 0.36
IGL01739:Scai APN 2 39094791 splice site probably benign
IGL02251:Scai APN 2 39099417 missense probably benign 0.01
IGL02274:Scai APN 2 39102317 unclassified probably benign
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0685:Scai UTSW 2 39103737 missense probably damaging 0.96
R0904:Scai UTSW 2 39075152 missense possibly damaging 0.90
R1655:Scai UTSW 2 39080117 missense possibly damaging 0.79
R1820:Scai UTSW 2 39106978 missense possibly damaging 0.82
R1913:Scai UTSW 2 39080081 missense probably damaging 1.00
R2068:Scai UTSW 2 39123013 missense probably damaging 1.00
R2183:Scai UTSW 2 39080126 missense probably benign 0.00
R3237:Scai UTSW 2 39150314 splice site probably benign
R3933:Scai UTSW 2 39075052 missense probably benign 0.44
R5460:Scai UTSW 2 39083574 missense probably damaging 1.00
R6089:Scai UTSW 2 39083554 nonsense probably null
R6377:Scai UTSW 2 39102328 missense probably benign 0.02
R6606:Scai UTSW 2 39075135 missense probably benign 0.00
R7034:Scai UTSW 2 39121135 missense probably damaging 1.00
R7037:Scai UTSW 2 39190621 missense probably benign 0.04
R7171:Scai UTSW 2 39106936 missense possibly damaging 0.48
R7451:Scai UTSW 2 39125136 missense probably damaging 1.00
R7737:Scai UTSW 2 39123022 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCACATTAGGGAAGCCTTG -3'
(R):5'- GTATTGAGACATGAACCATATGTCTGC -3'

Sequencing Primer
(F):5'- ATTAGGGAAGCCTTGTCCAC -3'
(R):5'- GAACCATATGTCTGCAACTGCTG -3'
Posted On2016-10-06