Incidental Mutation 'R5460:Ndufaf1'
ID432958
Institutional Source Beutler Lab
Gene Symbol Ndufaf1
Ensembl Gene ENSMUSG00000027305
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1
SynonymsCGI-65, 2410001M24Rik, CIA30
MMRRC Submission 042849-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R5460 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119655446-119662827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119660477 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 34 (D34A)
Ref Sequence ENSEMBL: ENSMUSP00000106426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028768] [ENSMUST00000110801] [ENSMUST00000110802]
Predicted Effect probably benign
Transcript: ENSMUST00000028768
AA Change: D36A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028768
Gene: ENSMUSG00000027305
AA Change: D36A

DomainStartEndE-ValueType
Pfam:CIA30 128 301 3e-51 PFAM
Pfam:CBM_11 193 315 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110801
AA Change: D34A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106425
Gene: ENSMUSG00000027305
AA Change: D34A

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110802
AA Change: D34A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106426
Gene: ENSMUSG00000027305
AA Change: D34A

DomainStartEndE-ValueType
Pfam:CIA30 126 299 1.1e-47 PFAM
Pfam:CBM_11 127 312 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154127
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a complex I assembly factor protein. Complex I (NADH-ubiquinone oxidoreductase) catalyzes the transfer of electrons from NADH to ubiquinone (coenzyme Q) in the first step of the mitochondrial respiratory chain, resulting in the translocation of protons across the inner mitochondrial membrane. The encoded protein is required for assembly of complex I, and mutations in this gene are a cause of mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 19. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,865 K94R probably benign Het
9530077C05Rik T C 9: 22,439,920 F453L probably benign Het
9930021J03Rik G T 19: 29,754,850 P254Q probably damaging Het
Actbl2 T A 13: 111,255,704 M191K probably benign Het
Actn1 T C 12: 80,183,568 N304S probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamtsl2 T A 2: 27,095,398 probably null Het
Adgrv1 T C 13: 81,424,258 E4928G possibly damaging Het
Alms1 T A 6: 85,696,731 C3103S probably benign Het
Appl2 T A 10: 83,602,832 I578F probably benign Het
Atp10b T C 11: 43,230,455 S982P probably benign Het
Capn7 T C 14: 31,368,203 probably null Het
Cd200r3 A G 16: 44,957,730 T166A possibly damaging Het
Dctn6 C T 8: 34,104,981 probably null Het
Fam114a1 T A 5: 65,028,433 F366I probably damaging Het
Fam98b A T 2: 117,259,256 S85C probably damaging Het
Fat3 T A 9: 15,919,167 N4344Y probably damaging Het
Fhl3 T G 4: 124,706,003 C92W probably damaging Het
Flrt1 T C 19: 7,095,740 T481A probably damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gm4981 G A 10: 58,235,895 H166Y possibly damaging Het
Gng2 G T 14: 19,891,358 N5K probably benign Het
Iqcm A T 8: 75,714,789 D230V probably benign Het
Limk2 T C 11: 3,352,332 I176V probably benign Het
Lrrk2 T A 15: 91,814,644 probably null Het
Maml1 T C 11: 50,266,353 T332A probably benign Het
Mbd1 T C 18: 74,269,510 F28L probably benign Het
Morf4l1 G A 9: 90,095,130 T246I probably benign Het
Olfr1219 C T 2: 89,074,864 V76I probably benign Het
Olfr1250 T A 2: 89,657,070 I124F probably damaging Het
Patl1 C T 19: 11,935,718 R542C possibly damaging Het
Pcdha2 T C 18: 36,939,421 V35A probably damaging Het
Phf11b G A 14: 59,331,264 P67S probably benign Het
Plxnd1 T C 6: 115,957,648 I1775V probably damaging Het
Ryr1 T A 7: 29,071,961 T2552S probably damaging Het
Scai A T 2: 39,083,573 L52H probably damaging Het
Scai G C 2: 39,083,574 L52V probably damaging Het
Stag1 A T 9: 100,956,453 probably null Het
Tgs1 A G 4: 3,586,170 K349R probably benign Het
Tpbgl T C 7: 99,625,754 I299V probably benign Het
Ttc3 A G 16: 94,457,382 T1325A probably benign Het
Ubxn11 A T 4: 134,125,085 E210D probably damaging Het
Unc13c T C 9: 73,545,989 I1840V probably benign Het
Zfp74 A T 7: 29,935,891 F131I probably benign Het
Other mutations in Ndufaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Ndufaf1 APN 2 119660469 missense probably damaging 1.00
IGL01871:Ndufaf1 APN 2 119658287 nonsense probably null
IGL02452:Ndufaf1 APN 2 119656426 missense probably damaging 1.00
IGL03087:Ndufaf1 APN 2 119655799 splice site probably benign
R1211:Ndufaf1 UTSW 2 119655675 missense probably damaging 1.00
R2420:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2421:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R2422:Ndufaf1 UTSW 2 119655737 missense probably damaging 1.00
R3824:Ndufaf1 UTSW 2 119660271 missense probably benign 0.30
R4942:Ndufaf1 UTSW 2 119660066 missense possibly damaging 0.83
R5382:Ndufaf1 UTSW 2 119660412 missense possibly damaging 0.75
R5732:Ndufaf1 UTSW 2 119660040 nonsense probably null
R5777:Ndufaf1 UTSW 2 119660482 nonsense probably null
R5919:Ndufaf1 UTSW 2 119660228 missense possibly damaging 0.51
R6371:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R6378:Ndufaf1 UTSW 2 119655726 missense probably damaging 0.99
R7202:Ndufaf1 UTSW 2 119658426 missense probably benign 0.39
R7224:Ndufaf1 UTSW 2 119658396 missense probably damaging 1.00
R7847:Ndufaf1 UTSW 2 119660053 missense probably damaging 1.00
R8208:Ndufaf1 UTSW 2 119660346 missense probably benign 0.01
R8319:Ndufaf1 UTSW 2 119660087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGCCTCTCAAATGAGC -3'
(R):5'- AGCCACTGTTGAGTAAATTGGG -3'

Sequencing Primer
(F):5'- GGCCTCTCAAATGAGCCACAATTTC -3'
(R):5'- ATTCATTGCTCTGCTGATAATTGG -3'
Posted On2016-10-06