Incidental Mutation 'R5460:Fhl3'
ID432960
Institutional Source Beutler Lab
Gene Symbol Fhl3
Ensembl Gene ENSMUSG00000032643
Gene Namefour and a half LIM domains 3
Synonyms
MMRRC Submission 042849-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R5460 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location124700701-124708611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 124706003 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 92 (C92W)
Ref Sequence ENSEMBL: ENSMUSP00000121702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038684] [ENSMUST00000106199] [ENSMUST00000145942]
Predicted Effect probably damaging
Transcript: ENSMUST00000038684
AA Change: C92W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040150
Gene: ENSMUSG00000032643
AA Change: C92W

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 284 2.91e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106199
AA Change: C92W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101805
Gene: ENSMUSG00000032643
AA Change: C92W

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 275 8.49e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145942
AA Change: C92W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121702
Gene: ENSMUSG00000032643
AA Change: C92W

DomainStartEndE-ValueType
Blast:LIM 1 31 5e-6 BLAST
LIM 39 92 2.7e-11 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,865 K94R probably benign Het
9530077C05Rik T C 9: 22,439,920 F453L probably benign Het
9930021J03Rik G T 19: 29,754,850 P254Q probably damaging Het
Actbl2 T A 13: 111,255,704 M191K probably benign Het
Actn1 T C 12: 80,183,568 N304S probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamtsl2 T A 2: 27,095,398 probably null Het
Adgrv1 T C 13: 81,424,258 E4928G possibly damaging Het
Alms1 T A 6: 85,696,731 C3103S probably benign Het
Appl2 T A 10: 83,602,832 I578F probably benign Het
Atp10b T C 11: 43,230,455 S982P probably benign Het
Capn7 T C 14: 31,368,203 probably null Het
Cd200r3 A G 16: 44,957,730 T166A possibly damaging Het
Dctn6 C T 8: 34,104,981 probably null Het
Fam114a1 T A 5: 65,028,433 F366I probably damaging Het
Fam98b A T 2: 117,259,256 S85C probably damaging Het
Fat3 T A 9: 15,919,167 N4344Y probably damaging Het
Flrt1 T C 19: 7,095,740 T481A probably damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gm4981 G A 10: 58,235,895 H166Y possibly damaging Het
Gng2 G T 14: 19,891,358 N5K probably benign Het
Iqcm A T 8: 75,714,789 D230V probably benign Het
Limk2 T C 11: 3,352,332 I176V probably benign Het
Lrrk2 T A 15: 91,814,644 probably null Het
Maml1 T C 11: 50,266,353 T332A probably benign Het
Mbd1 T C 18: 74,269,510 F28L probably benign Het
Morf4l1 G A 9: 90,095,130 T246I probably benign Het
Ndufaf1 T G 2: 119,660,477 D34A probably benign Het
Olfr1219 C T 2: 89,074,864 V76I probably benign Het
Olfr1250 T A 2: 89,657,070 I124F probably damaging Het
Patl1 C T 19: 11,935,718 R542C possibly damaging Het
Pcdha2 T C 18: 36,939,421 V35A probably damaging Het
Phf11b G A 14: 59,331,264 P67S probably benign Het
Plxnd1 T C 6: 115,957,648 I1775V probably damaging Het
Ryr1 T A 7: 29,071,961 T2552S probably damaging Het
Scai A T 2: 39,083,573 L52H probably damaging Het
Scai G C 2: 39,083,574 L52V probably damaging Het
Stag1 A T 9: 100,956,453 probably null Het
Tgs1 A G 4: 3,586,170 K349R probably benign Het
Tpbgl T C 7: 99,625,754 I299V probably benign Het
Ttc3 A G 16: 94,457,382 T1325A probably benign Het
Ubxn11 A T 4: 134,125,085 E210D probably damaging Het
Unc13c T C 9: 73,545,989 I1840V probably benign Het
Zfp74 A T 7: 29,935,891 F131I probably benign Het
Other mutations in Fhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0592:Fhl3 UTSW 4 124705677 missense probably benign 0.23
R1118:Fhl3 UTSW 4 124705791 critical splice donor site probably null
R2402:Fhl3 UTSW 4 124705688 missense probably damaging 1.00
R2921:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R2923:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R4583:Fhl3 UTSW 4 124707549 missense probably benign 0.41
R5147:Fhl3 UTSW 4 124707931 missense probably benign 0.01
R5932:Fhl3 UTSW 4 124705727 missense probably damaging 1.00
R6855:Fhl3 UTSW 4 124707522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTGGGCATGATTCAAGGG -3'
(R):5'- ACATACAGCGTGTGGAGGTC -3'

Sequencing Primer
(F):5'- GCATGATTCAAGGGTAAGGACC -3'
(R):5'- ACCTGACTCAGCAATTCC -3'
Posted On2016-10-06