Incidental Mutation 'R5460:Plxnd1'
ID432964
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission 042849-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5460 (G1)
Quality Score178
Status Not validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115957648 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1775 (I1775V)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably damaging
Transcript: ENSMUST00000015511
AA Change: I1775V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: I1775V

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205003
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,865 K94R probably benign Het
9530077C05Rik T C 9: 22,439,920 F453L probably benign Het
9930021J03Rik G T 19: 29,754,850 P254Q probably damaging Het
Actbl2 T A 13: 111,255,704 M191K probably benign Het
Actn1 T C 12: 80,183,568 N304S probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamtsl2 T A 2: 27,095,398 probably null Het
Adgrv1 T C 13: 81,424,258 E4928G possibly damaging Het
Alms1 T A 6: 85,696,731 C3103S probably benign Het
Appl2 T A 10: 83,602,832 I578F probably benign Het
Atp10b T C 11: 43,230,455 S982P probably benign Het
Capn7 T C 14: 31,368,203 probably null Het
Cd200r3 A G 16: 44,957,730 T166A possibly damaging Het
Dctn6 C T 8: 34,104,981 probably null Het
Fam114a1 T A 5: 65,028,433 F366I probably damaging Het
Fam98b A T 2: 117,259,256 S85C probably damaging Het
Fat3 T A 9: 15,919,167 N4344Y probably damaging Het
Fhl3 T G 4: 124,706,003 C92W probably damaging Het
Flrt1 T C 19: 7,095,740 T481A probably damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gm4981 G A 10: 58,235,895 H166Y possibly damaging Het
Gng2 G T 14: 19,891,358 N5K probably benign Het
Iqcm A T 8: 75,714,789 D230V probably benign Het
Limk2 T C 11: 3,352,332 I176V probably benign Het
Lrrk2 T A 15: 91,814,644 probably null Het
Maml1 T C 11: 50,266,353 T332A probably benign Het
Mbd1 T C 18: 74,269,510 F28L probably benign Het
Morf4l1 G A 9: 90,095,130 T246I probably benign Het
Ndufaf1 T G 2: 119,660,477 D34A probably benign Het
Olfr1219 C T 2: 89,074,864 V76I probably benign Het
Olfr1250 T A 2: 89,657,070 I124F probably damaging Het
Patl1 C T 19: 11,935,718 R542C possibly damaging Het
Pcdha2 T C 18: 36,939,421 V35A probably damaging Het
Phf11b G A 14: 59,331,264 P67S probably benign Het
Ryr1 T A 7: 29,071,961 T2552S probably damaging Het
Scai A T 2: 39,083,573 L52H probably damaging Het
Scai G C 2: 39,083,574 L52V probably damaging Het
Stag1 A T 9: 100,956,453 probably null Het
Tgs1 A G 4: 3,586,170 K349R probably benign Het
Tpbgl T C 7: 99,625,754 I299V probably benign Het
Ttc3 A G 16: 94,457,382 T1325A probably benign Het
Ubxn11 A T 4: 134,125,085 E210D probably damaging Het
Unc13c T C 9: 73,545,989 I1840V probably benign Het
Zfp74 A T 7: 29,935,891 F131I probably benign Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCTGTCTTGAATGACTCCGG -3'
(R):5'- ATGAGAACCAGGAGTCTCGTGTG -3'

Sequencing Primer
(F):5'- TCCGGTAGAGTTCAGGCAC -3'
(R):5'- CTCGTGTGCGTGCAAAG -3'
Posted On2016-10-06