Incidental Mutation 'R5460:Zfp74'
ID432966
Institutional Source Beutler Lab
Gene Symbol Zfp74
Ensembl Gene ENSMUSG00000059975
Gene Namezinc finger protein 74
SynonymsKRAB8, 2810054M15Rik, Zfp66
MMRRC Submission 042849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5460 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29930815-29954089 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29935891 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 131 (F131I)
Ref Sequence ENSEMBL: ENSMUSP00000103840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032797] [ENSMUST00000108205] [ENSMUST00000108211] [ENSMUST00000108212]
Predicted Effect probably benign
Transcript: ENSMUST00000032797
AA Change: F131I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032797
Gene: ENSMUSG00000059975
AA Change: F131I

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108205
AA Change: F131I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103840
Gene: ENSMUSG00000059975
AA Change: F131I

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
ZnF_C2H2 179 201 1.84e-4 SMART
ZnF_C2H2 207 229 2.36e-2 SMART
ZnF_C2H2 235 257 1.5e-4 SMART
ZnF_C2H2 263 285 2.79e-4 SMART
ZnF_C2H2 291 313 3.49e-5 SMART
ZnF_C2H2 319 341 6.42e-4 SMART
ZnF_C2H2 347 369 5.59e-4 SMART
ZnF_C2H2 375 397 5.21e-4 SMART
ZnF_C2H2 403 425 3.63e-3 SMART
ZnF_C2H2 431 453 1.82e-3 SMART
ZnF_C2H2 459 481 1.58e-3 SMART
ZnF_C2H2 487 509 2.12e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.24e-3 SMART
ZnF_C2H2 571 593 8.02e-5 SMART
ZnF_C2H2 599 621 1.04e-3 SMART
ZnF_C2H2 627 649 1.04e-3 SMART
ZnF_C2H2 655 677 9.88e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108211
SMART Domains Protein: ENSMUSP00000103846
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108212
SMART Domains Protein: ENSMUSP00000103847
Gene: ENSMUSG00000059975

DomainStartEndE-ValueType
KRAB 8 68 5.02e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149793
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,865 K94R probably benign Het
9530077C05Rik T C 9: 22,439,920 F453L probably benign Het
9930021J03Rik G T 19: 29,754,850 P254Q probably damaging Het
Actbl2 T A 13: 111,255,704 M191K probably benign Het
Actn1 T C 12: 80,183,568 N304S probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adamtsl2 T A 2: 27,095,398 probably null Het
Adgrv1 T C 13: 81,424,258 E4928G possibly damaging Het
Alms1 T A 6: 85,696,731 C3103S probably benign Het
Appl2 T A 10: 83,602,832 I578F probably benign Het
Atp10b T C 11: 43,230,455 S982P probably benign Het
Capn7 T C 14: 31,368,203 probably null Het
Cd200r3 A G 16: 44,957,730 T166A possibly damaging Het
Dctn6 C T 8: 34,104,981 probably null Het
Fam114a1 T A 5: 65,028,433 F366I probably damaging Het
Fam98b A T 2: 117,259,256 S85C probably damaging Het
Fat3 T A 9: 15,919,167 N4344Y probably damaging Het
Fhl3 T G 4: 124,706,003 C92W probably damaging Het
Flrt1 T C 19: 7,095,740 T481A probably damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gm4981 G A 10: 58,235,895 H166Y possibly damaging Het
Gng2 G T 14: 19,891,358 N5K probably benign Het
Iqcm A T 8: 75,714,789 D230V probably benign Het
Limk2 T C 11: 3,352,332 I176V probably benign Het
Lrrk2 T A 15: 91,814,644 probably null Het
Maml1 T C 11: 50,266,353 T332A probably benign Het
Mbd1 T C 18: 74,269,510 F28L probably benign Het
Morf4l1 G A 9: 90,095,130 T246I probably benign Het
Ndufaf1 T G 2: 119,660,477 D34A probably benign Het
Olfr1219 C T 2: 89,074,864 V76I probably benign Het
Olfr1250 T A 2: 89,657,070 I124F probably damaging Het
Patl1 C T 19: 11,935,718 R542C possibly damaging Het
Pcdha2 T C 18: 36,939,421 V35A probably damaging Het
Phf11b G A 14: 59,331,264 P67S probably benign Het
Plxnd1 T C 6: 115,957,648 I1775V probably damaging Het
Ryr1 T A 7: 29,071,961 T2552S probably damaging Het
Scai A T 2: 39,083,573 L52H probably damaging Het
Scai G C 2: 39,083,574 L52V probably damaging Het
Stag1 A T 9: 100,956,453 probably null Het
Tgs1 A G 4: 3,586,170 K349R probably benign Het
Tpbgl T C 7: 99,625,754 I299V probably benign Het
Ttc3 A G 16: 94,457,382 T1325A probably benign Het
Ubxn11 A T 4: 134,125,085 E210D probably damaging Het
Unc13c T C 9: 73,545,989 I1840V probably benign Het
Other mutations in Zfp74
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0355:Zfp74 UTSW 7 29954041 start gained probably benign
R0387:Zfp74 UTSW 7 29934754 missense probably benign 0.05
R0948:Zfp74 UTSW 7 29935937 critical splice donor site probably null
R1757:Zfp74 UTSW 7 29935061 missense probably benign 0.01
R1813:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1893:Zfp74 UTSW 7 29936045 critical splice acceptor site probably null
R1896:Zfp74 UTSW 7 29935144 missense probably damaging 1.00
R1958:Zfp74 UTSW 7 29935711 missense probably benign 0.08
R2092:Zfp74 UTSW 7 29953924 start gained probably benign
R2111:Zfp74 UTSW 7 29935018 nonsense probably null
R4894:Zfp74 UTSW 7 29936045 critical splice acceptor site probably benign
R5121:Zfp74 UTSW 7 29932507 intron probably null
R5123:Zfp74 UTSW 7 29934733 missense probably damaging 1.00
R5129:Zfp74 UTSW 7 29932455 missense probably benign 0.00
R5213:Zfp74 UTSW 7 29935243 missense probably damaging 1.00
R5519:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R5589:Zfp74 UTSW 7 29934565 missense probably damaging 1.00
R6287:Zfp74 UTSW 7 29935776 missense probably benign
R6330:Zfp74 UTSW 7 29937987 missense probably damaging 1.00
R6370:Zfp74 UTSW 7 29932410 missense probably damaging 0.96
R6407:Zfp74 UTSW 7 29935623 missense probably damaging 1.00
R6694:Zfp74 UTSW 7 29935134 missense probably damaging 0.99
R6791:Zfp74 UTSW 7 29934435 missense probably benign 0.02
R7144:Zfp74 UTSW 7 29935165 missense probably damaging 0.98
R7662:Zfp74 UTSW 7 29953853 critical splice donor site probably null
R7667:Zfp74 UTSW 7 29935183 missense probably damaging 1.00
R7898:Zfp74 UTSW 7 29935955 nonsense probably null
R7981:Zfp74 UTSW 7 29935955 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTCCAGGGTCTGACTAAAGC -3'
(R):5'- GGTATTTCAGTGTCAGAACCGG -3'

Sequencing Primer
(F):5'- AGGGTCTGACTAAAGCCTTTTC -3'
(R):5'- GAACCACGAGGGATACTTCTTTGC -3'
Posted On2016-10-06