Incidental Mutation 'R5460:Acyp2'
ID432981
Institutional Source Beutler Lab
Gene Symbol Acyp2
Ensembl Gene ENSMUSG00000060923
Gene Nameacylphosphatase 2, muscle type
Synonyms
MMRRC Submission 042849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R5460 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30505991-30649587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30506354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 98 (E98K)
Ref Sequence ENSEMBL: ENSMUSP00000074195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074613
AA Change: E98K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074195
Gene: ENSMUSG00000060923
AA Change: E98K

DomainStartEndE-ValueType
Pfam:Acylphosphatase 10 105 1.5e-26 PFAM
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acylphosphatase can hydrolyze the phosphoenzyme intermediate of different membrane pumps, particularly the Ca2+/Mg2+-ATPase from sarcoplasmic reticulum of skeletal muscle. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase on the basis of their tissue localization. This gene encodes the muscle-type isoform (MT). An increase of the MT isoform is associated with muscle differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,532,865 K94R probably benign Het
9530077C05Rik T C 9: 22,439,920 F453L probably benign Het
9930021J03Rik G T 19: 29,754,850 P254Q probably damaging Het
Actbl2 T A 13: 111,255,704 M191K probably benign Het
Actn1 T C 12: 80,183,568 N304S probably benign Het
Adamtsl2 T A 2: 27,095,398 probably null Het
Adgrv1 T C 13: 81,424,258 E4928G possibly damaging Het
Alms1 T A 6: 85,696,731 C3103S probably benign Het
Appl2 T A 10: 83,602,832 I578F probably benign Het
Atp10b T C 11: 43,230,455 S982P probably benign Het
Capn7 T C 14: 31,368,203 probably null Het
Cd200r3 A G 16: 44,957,730 T166A possibly damaging Het
Dctn6 C T 8: 34,104,981 probably null Het
Fam114a1 T A 5: 65,028,433 F366I probably damaging Het
Fam98b A T 2: 117,259,256 S85C probably damaging Het
Fat3 T A 9: 15,919,167 N4344Y probably damaging Het
Fhl3 T G 4: 124,706,003 C92W probably damaging Het
Flrt1 T C 19: 7,095,740 T481A probably damaging Het
Gm16286 C T 18: 80,211,923 A144V probably damaging Het
Gm4981 G A 10: 58,235,895 H166Y possibly damaging Het
Gng2 G T 14: 19,891,358 N5K probably benign Het
Iqcm A T 8: 75,714,789 D230V probably benign Het
Limk2 T C 11: 3,352,332 I176V probably benign Het
Lrrk2 T A 15: 91,814,644 probably null Het
Maml1 T C 11: 50,266,353 T332A probably benign Het
Mbd1 T C 18: 74,269,510 F28L probably benign Het
Morf4l1 G A 9: 90,095,130 T246I probably benign Het
Ndufaf1 T G 2: 119,660,477 D34A probably benign Het
Olfr1219 C T 2: 89,074,864 V76I probably benign Het
Olfr1250 T A 2: 89,657,070 I124F probably damaging Het
Patl1 C T 19: 11,935,718 R542C possibly damaging Het
Pcdha2 T C 18: 36,939,421 V35A probably damaging Het
Phf11b G A 14: 59,331,264 P67S probably benign Het
Plxnd1 T C 6: 115,957,648 I1775V probably damaging Het
Ryr1 T A 7: 29,071,961 T2552S probably damaging Het
Scai A T 2: 39,083,573 L52H probably damaging Het
Scai G C 2: 39,083,574 L52V probably damaging Het
Stag1 A T 9: 100,956,453 probably null Het
Tgs1 A G 4: 3,586,170 K349R probably benign Het
Tpbgl T C 7: 99,625,754 I299V probably benign Het
Ttc3 A G 16: 94,457,382 T1325A probably benign Het
Ubxn11 A T 4: 134,125,085 E210D probably damaging Het
Unc13c T C 9: 73,545,989 I1840V probably benign Het
Zfp74 A T 7: 29,935,891 F131I probably benign Het
Other mutations in Acyp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Acyp2 APN 11 30506362 missense probably benign 0.07
IGL02365:Acyp2 APN 11 30649318 missense probably damaging 1.00
R1470:Acyp2 UTSW 11 30506452 splice site probably benign
R2419:Acyp2 UTSW 11 30632316 missense probably benign 0.20
R5389:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5393:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5423:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5425:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5426:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5462:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5464:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5560:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5561:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5602:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5826:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5901:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5902:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5999:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6046:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6066:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6107:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6128:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6196:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6198:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGCTTGCTAAAACATAGGTGAG -3'
(R):5'- GAGCAAGGTAATACTGACCTTGAAG -3'

Sequencing Primer
(F):5'- AGGTGAGTAAATGTTTTCAGTTTCAG -3'
(R):5'- GGTAATACTGACCTTGAAGAGTTTG -3'
Posted On2016-10-06