Incidental Mutation 'R5461:Mcm3'
ID432999
Institutional Source Beutler Lab
Gene Symbol Mcm3
Ensembl Gene ENSMUSG00000041859
Gene Nameminichromosome maintenance complex component 3
SynonymsP1, p1.m, Mcmd
MMRRC Submission 043023-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5461 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20802968-20820312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20814437 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 281 (I281V)
Ref Sequence ENSEMBL: ENSMUSP00000059192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053266]
Predicted Effect probably benign
Transcript: ENSMUST00000053266
AA Change: I281V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859
AA Change: I281V

DomainStartEndE-ValueType
MCM 109 654 N/A SMART
AAA 337 490 1.92e-4 SMART
coiled coil region 655 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185296
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,777 I405K possibly damaging Het
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Adgrg6 A T 10: 14,420,504 W1079R probably damaging Het
Arsa T C 15: 89,473,275 H495R probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Brsk2 T C 7: 141,987,906 L152P probably damaging Het
C8a T C 4: 104,815,845 probably benign Het
Ccdc177 G A 12: 80,758,042 A486V unknown Het
Cpa2 A G 6: 30,544,181 T38A probably benign Het
Crim1 T G 17: 78,237,807 C133G probably damaging Het
Dnah2 C T 11: 69,473,351 probably null Het
Ep400 G A 5: 110,676,684 Q2392* probably null Het
Exoc2 C T 13: 30,925,755 S210N possibly damaging Het
Gm7003 A G 12: 113,803,227 probably benign Het
Hydin A G 8: 110,519,231 K2192R probably damaging Het
Ica1l T C 1: 60,013,851 D176G probably damaging Het
Ints10 G A 8: 68,794,041 E8K possibly damaging Het
Itgb8 T C 12: 119,168,005 E635G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kng1 A G 16: 23,079,137 H429R probably benign Het
Msi1 T C 5: 115,441,391 S200P possibly damaging Het
Nat3 T C 8: 67,547,862 L131P probably damaging Het
Ncor2 T C 5: 125,027,113 E1752G probably damaging Het
Nnt C T 13: 119,368,595 A414T possibly damaging Het
Nrp2 C T 1: 62,747,211 Q292* probably null Het
Olfr552 G A 7: 102,604,408 G18D probably damaging Het
Olfr615 T A 7: 103,560,573 L32Q probably damaging Het
Otop1 A T 5: 38,299,715 I273F probably damaging Het
Phactr3 T A 2: 178,278,901 N177K probably benign Het
Pik3c2b C T 1: 133,099,702 T1313I possibly damaging Het
Pikfyve C A 1: 65,235,033 D677E probably damaging Het
Poc1a T C 9: 106,288,010 F157L probably damaging Het
Prodh2 G T 7: 30,494,523 R185L possibly damaging Het
Rcc1 T C 4: 132,334,186 I350M probably benign Het
Rhd G A 4: 134,884,617 A249T probably damaging Het
Rtf2 A G 2: 172,445,332 Y57C probably damaging Het
Shmt1 A G 11: 60,794,899 S284P possibly damaging Het
Shpk T C 11: 73,199,535 V6A probably benign Het
Slc4a5 T C 6: 83,285,854 V661A probably benign Het
Spesp1 A T 9: 62,272,732 L298Q probably damaging Het
Tas1r2 C A 4: 139,660,009 Q231K probably benign Het
Tcp11l1 T C 2: 104,688,511 Y280C probably benign Het
Tnip1 T C 11: 54,910,799 probably benign Het
Topbp1 T A 9: 103,315,196 D295E probably benign Het
Unc79 C T 12: 103,112,138 L1521F probably damaging Het
Usp10 T C 8: 119,956,667 I759T probably benign Het
Vmn1r30 A T 6: 58,435,774 C24* probably null Het
Vmn2r104 T A 17: 20,030,081 I643F probably damaging Het
Wwc1 T A 11: 35,867,372 T716S probably damaging Het
Zfp949 C T 9: 88,569,484 T369M probably benign Het
Zhx3 A G 2: 160,780,018 V743A probably benign Het
Other mutations in Mcm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Mcm3 APN 1 20804815 critical splice donor site probably null
IGL01061:Mcm3 APN 1 20814496 missense possibly damaging 0.86
IGL01488:Mcm3 APN 1 20813056 missense possibly damaging 0.90
IGL01609:Mcm3 APN 1 20814680 splice site probably benign
IGL02483:Mcm3 APN 1 20803572 missense possibly damaging 0.68
IGL02869:Mcm3 APN 1 20808839 missense probably damaging 0.99
R0197:Mcm3 UTSW 1 20810105 missense probably damaging 1.00
R0462:Mcm3 UTSW 1 20805332 missense probably benign
R0467:Mcm3 UTSW 1 20804847 missense probably benign
R0669:Mcm3 UTSW 1 20804929 intron probably null
R1251:Mcm3 UTSW 1 20812672 nonsense probably null
R1599:Mcm3 UTSW 1 20820198 missense probably benign 0.08
R1764:Mcm3 UTSW 1 20805879 missense probably damaging 0.98
R2015:Mcm3 UTSW 1 20803580 missense probably damaging 0.98
R2140:Mcm3 UTSW 1 20813110 missense probably benign 0.00
R3033:Mcm3 UTSW 1 20808768 missense probably damaging 1.00
R4430:Mcm3 UTSW 1 20811993 nonsense probably null
R4513:Mcm3 UTSW 1 20810232 missense probably damaging 1.00
R4563:Mcm3 UTSW 1 20809645 missense probably benign
R4713:Mcm3 UTSW 1 20803577 missense probably benign
R4801:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4802:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4896:Mcm3 UTSW 1 20820256 utr 5 prime probably benign
R5035:Mcm3 UTSW 1 20803418 utr 3 prime probably benign
R5486:Mcm3 UTSW 1 20814894 missense probably damaging 1.00
R5531:Mcm3 UTSW 1 20803544 missense possibly damaging 0.46
R5759:Mcm3 UTSW 1 20808748 frame shift probably null
R5760:Mcm3 UTSW 1 20808748 frame shift probably null
R6505:Mcm3 UTSW 1 20803544 missense probably damaging 1.00
R6833:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R6834:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R7179:Mcm3 UTSW 1 20814857 missense probably damaging 0.98
R7514:Mcm3 UTSW 1 20805896 missense probably benign 0.19
R7673:Mcm3 UTSW 1 20812014 missense probably damaging 1.00
R7689:Mcm3 UTSW 1 20806773 missense probably benign 0.29
R7718:Mcm3 UTSW 1 20817274 nonsense probably null
X0062:Mcm3 UTSW 1 20820137 missense possibly damaging 0.49
Z1176:Mcm3 UTSW 1 20820181 missense not run
Predicted Primers PCR Primer
(F):5'- TTCAACTGAGCAGCCCAGAAG -3'
(R):5'- AAACAGGCATTCCGTCCTC -3'

Sequencing Primer
(F):5'- ACCTTTAACTTGTCAGTTGGAAC -3'
(R):5'- AGGCATTCCGTCCTCACTGTG -3'
Posted On2016-10-06