Incidental Mutation 'R5461:C8a'
ID433008
Institutional Source Beutler Lab
Gene Symbol C8a
Ensembl Gene ENSMUSG00000035031
Gene Namecomplement component 8, alpha polypeptide
Synonyms
MMRRC Submission 043023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5461 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location104815679-104876398 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 104815845 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048947] [ENSMUST00000064873] [ENSMUST00000106808]
Predicted Effect probably benign
Transcript: ENSMUST00000048947
SMART Domains Protein: ENSMUSP00000047606
Gene: ENSMUSG00000035031

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 3e-13 BLAST
Blast:TSP1 545 573 3e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000064873
SMART Domains Protein: ENSMUSP00000067541
Gene: ENSMUSG00000035031

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 41 91 1.33e-1 SMART
LDLa 95 132 2.07e-11 SMART
MACPF 288 492 5.26e-58 SMART
Blast:EGF 496 529 4e-13 BLAST
TSP1 545 587 1.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106808
SMART Domains Protein: ENSMUSP00000102420
Gene: ENSMUSG00000035031

DomainStartEndE-ValueType
Blast:TSP1 4 47 3e-15 BLAST
LDLa 51 88 2.07e-11 SMART
MACPF 244 448 5.26e-58 SMART
Blast:EGF 452 485 4e-13 BLAST
Blast:TSP1 501 543 3e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152146
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: This gene encodes the alpha subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the alpha subunit, which associates with the beta and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the beta subunit. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,777 I405K possibly damaging Het
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Adgrg6 A T 10: 14,420,504 W1079R probably damaging Het
Arsa T C 15: 89,473,275 H495R probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Brsk2 T C 7: 141,987,906 L152P probably damaging Het
Ccdc177 G A 12: 80,758,042 A486V unknown Het
Cpa2 A G 6: 30,544,181 T38A probably benign Het
Crim1 T G 17: 78,237,807 C133G probably damaging Het
Dnah2 C T 11: 69,473,351 probably null Het
Ep400 G A 5: 110,676,684 Q2392* probably null Het
Exoc2 C T 13: 30,925,755 S210N possibly damaging Het
Gm7003 A G 12: 113,803,227 probably benign Het
Hydin A G 8: 110,519,231 K2192R probably damaging Het
Ica1l T C 1: 60,013,851 D176G probably damaging Het
Ints10 G A 8: 68,794,041 E8K possibly damaging Het
Itgb8 T C 12: 119,168,005 E635G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kng1 A G 16: 23,079,137 H429R probably benign Het
Mcm3 T C 1: 20,814,437 I281V probably benign Het
Msi1 T C 5: 115,441,391 S200P possibly damaging Het
Nat3 T C 8: 67,547,862 L131P probably damaging Het
Ncor2 T C 5: 125,027,113 E1752G probably damaging Het
Nnt C T 13: 119,368,595 A414T possibly damaging Het
Nrp2 C T 1: 62,747,211 Q292* probably null Het
Olfr552 G A 7: 102,604,408 G18D probably damaging Het
Olfr615 T A 7: 103,560,573 L32Q probably damaging Het
Otop1 A T 5: 38,299,715 I273F probably damaging Het
Phactr3 T A 2: 178,278,901 N177K probably benign Het
Pik3c2b C T 1: 133,099,702 T1313I possibly damaging Het
Pikfyve C A 1: 65,235,033 D677E probably damaging Het
Poc1a T C 9: 106,288,010 F157L probably damaging Het
Prodh2 G T 7: 30,494,523 R185L possibly damaging Het
Rcc1 T C 4: 132,334,186 I350M probably benign Het
Rhd G A 4: 134,884,617 A249T probably damaging Het
Rtf2 A G 2: 172,445,332 Y57C probably damaging Het
Shmt1 A G 11: 60,794,899 S284P possibly damaging Het
Shpk T C 11: 73,199,535 V6A probably benign Het
Slc4a5 T C 6: 83,285,854 V661A probably benign Het
Spesp1 A T 9: 62,272,732 L298Q probably damaging Het
Tas1r2 C A 4: 139,660,009 Q231K probably benign Het
Tcp11l1 T C 2: 104,688,511 Y280C probably benign Het
Tnip1 T C 11: 54,910,799 probably benign Het
Topbp1 T A 9: 103,315,196 D295E probably benign Het
Unc79 C T 12: 103,112,138 L1521F probably damaging Het
Usp10 T C 8: 119,956,667 I759T probably benign Het
Vmn1r30 A T 6: 58,435,774 C24* probably null Het
Vmn2r104 T A 17: 20,030,081 I643F probably damaging Het
Wwc1 T A 11: 35,867,372 T716S probably damaging Het
Zfp949 C T 9: 88,569,484 T369M probably benign Het
Zhx3 A G 2: 160,780,018 V743A probably benign Het
Other mutations in C8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:C8a APN 4 104865445 intron probably benign
IGL01326:C8a APN 4 104856420 missense probably damaging 1.00
IGL01339:C8a APN 4 104827985 missense probably benign 0.00
IGL01809:C8a APN 4 104845942 missense probably benign 0.06
IGL01843:C8a APN 4 104862611 nonsense probably null
IGL01988:C8a APN 4 104826694 missense probably damaging 1.00
IGL02187:C8a APN 4 104862736 missense probably damaging 1.00
IGL02430:C8a APN 4 104817522 missense probably damaging 0.97
IGL02537:C8a APN 4 104845951 missense probably damaging 1.00
derogation UTSW 4 104828078 missense possibly damaging 0.50
insult UTSW 4 104828039 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0045:C8a UTSW 4 104826815 missense probably benign 0.00
R0367:C8a UTSW 4 104862594 critical splice donor site probably null
R0632:C8a UTSW 4 104856492 missense probably damaging 1.00
R1013:C8a UTSW 4 104828039 missense probably benign 0.00
R1442:C8a UTSW 4 104828078 missense possibly damaging 0.50
R1902:C8a UTSW 4 104856601 critical splice acceptor site probably null
R2969:C8a UTSW 4 104853777 missense probably damaging 0.97
R3735:C8a UTSW 4 104817615 missense probably benign 0.43
R3736:C8a UTSW 4 104817615 missense probably benign 0.43
R4245:C8a UTSW 4 104876346 missense probably benign 0.00
R4707:C8a UTSW 4 104856421 missense probably damaging 1.00
R4812:C8a UTSW 4 104862591 splice site probably null
R5221:C8a UTSW 4 104845925 missense probably damaging 1.00
R5279:C8a UTSW 4 104845988 missense probably damaging 1.00
R5881:C8a UTSW 4 104853932 missense probably damaging 0.99
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6039:C8a UTSW 4 104845942 missense probably benign 0.00
R6191:C8a UTSW 4 104845903 missense probably benign 0.00
R6626:C8a UTSW 4 104845967 missense probably benign 0.01
R7438:C8a UTSW 4 104861429 missense probably damaging 0.97
R7471:C8a UTSW 4 104817625 missense probably benign 0.01
R7514:C8a UTSW 4 104846050 missense possibly damaging 0.94
R7596:C8a UTSW 4 104853867 missense possibly damaging 0.49
X0012:C8a UTSW 4 104826782 missense probably damaging 1.00
X0019:C8a UTSW 4 104817586 missense probably damaging 1.00
Z1176:C8a UTSW 4 104862686 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGAACGGAGTCTTTTCTTTC -3'
(R):5'- GGCCACTGGGAGTAAATTATTAAC -3'

Sequencing Primer
(F):5'- CTTTCTTTCAGATAGAAGAGCCAAG -3'
(R):5'- TGTAGCATCCAAGTGACTGC -3'
Posted On2016-10-06