Incidental Mutation 'R5461:Rcc1'
ID433009
Institutional Source Beutler Lab
Gene Symbol Rcc1
Ensembl Gene ENSMUSG00000028896
Gene Nameregulator of chromosome condensation 1
SynonymsChc1, 4931417M11Rik
MMRRC Submission 043023-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5461 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132331919-132353605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132334186 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 350 (I350M)
Ref Sequence ENSEMBL: ENSMUSP00000030726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030726] [ENSMUST00000030730] [ENSMUST00000084250] [ENSMUST00000105951] [ENSMUST00000105960] [ENSMUST00000105962] [ENSMUST00000125513] [ENSMUST00000127402] [ENSMUST00000137520] [ENSMUST00000147652] [ENSMUST00000155129]
Predicted Effect probably benign
Transcript: ENSMUST00000030726
AA Change: I350M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030726
Gene: ENSMUSG00000028896
AA Change: I350M

DomainStartEndE-ValueType
Pfam:RCC1 47 95 7.9e-12 PFAM
Pfam:RCC1 98 147 7.5e-17 PFAM
Pfam:RCC1_2 134 165 1.3e-11 PFAM
Pfam:RCC1 150 200 9.9e-10 PFAM
Pfam:RCC1_2 187 216 3.2e-7 PFAM
Pfam:RCC1 203 268 4.2e-14 PFAM
Pfam:RCC1 271 322 1.1e-11 PFAM
Pfam:RCC1 325 373 3.4e-10 PFAM
Pfam:RCC1 376 427 3.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030730
SMART Domains Protein: ENSMUSP00000030730
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
RRM 97 171 2.2e-11 SMART
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084250
AA Change: I337M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081271
Gene: ENSMUSG00000028896
AA Change: I337M

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105951
AA Change: I337M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101571
Gene: ENSMUSG00000028896
AA Change: I337M

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105960
SMART Domains Protein: ENSMUSP00000101580
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
PDB:2DHG|A 21 70 9e-25 PDB
SCOP:d1fj7a_ 22 70 7e-7 SMART
Blast:RRM 31 70 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105962
SMART Domains Protein: ENSMUSP00000101582
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
PDB:2DHG|A 87 137 7e-24 PDB
SCOP:d1cvja1 97 137 9e-5 SMART
Blast:RRM 97 138 2e-20 BLAST
low complexity region 145 164 N/A INTRINSIC
low complexity region 173 189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125513
Predicted Effect probably benign
Transcript: ENSMUST00000127402
SMART Domains Protein: ENSMUSP00000120657
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 3.66e-8 SMART
low complexity region 101 120 N/A INTRINSIC
low complexity region 129 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137238
Predicted Effect probably benign
Transcript: ENSMUST00000137520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146166
Predicted Effect probably benign
Transcript: ENSMUST00000147652
SMART Domains Protein: ENSMUSP00000127273
Gene: ENSMUSG00000028898

DomainStartEndE-ValueType
RRM 4 78 1.73e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150959
Predicted Effect probably benign
Transcript: ENSMUST00000155129
SMART Domains Protein: ENSMUSP00000120701
Gene: ENSMUSG00000028896

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 3.9e-13 PFAM
Pfam:RCC1_2 69 98 5.2e-7 PFAM
Pfam:RCC1 85 116 5.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155194
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,777 I405K possibly damaging Het
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Adgrg6 A T 10: 14,420,504 W1079R probably damaging Het
Arsa T C 15: 89,473,275 H495R probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Brsk2 T C 7: 141,987,906 L152P probably damaging Het
C8a T C 4: 104,815,845 probably benign Het
Ccdc177 G A 12: 80,758,042 A486V unknown Het
Cpa2 A G 6: 30,544,181 T38A probably benign Het
Crim1 T G 17: 78,237,807 C133G probably damaging Het
Dnah2 C T 11: 69,473,351 probably null Het
Ep400 G A 5: 110,676,684 Q2392* probably null Het
Exoc2 C T 13: 30,925,755 S210N possibly damaging Het
Gm7003 A G 12: 113,803,227 probably benign Het
Hydin A G 8: 110,519,231 K2192R probably damaging Het
Ica1l T C 1: 60,013,851 D176G probably damaging Het
Ints10 G A 8: 68,794,041 E8K possibly damaging Het
Itgb8 T C 12: 119,168,005 E635G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kng1 A G 16: 23,079,137 H429R probably benign Het
Mcm3 T C 1: 20,814,437 I281V probably benign Het
Msi1 T C 5: 115,441,391 S200P possibly damaging Het
Nat3 T C 8: 67,547,862 L131P probably damaging Het
Ncor2 T C 5: 125,027,113 E1752G probably damaging Het
Nnt C T 13: 119,368,595 A414T possibly damaging Het
Nrp2 C T 1: 62,747,211 Q292* probably null Het
Olfr552 G A 7: 102,604,408 G18D probably damaging Het
Olfr615 T A 7: 103,560,573 L32Q probably damaging Het
Otop1 A T 5: 38,299,715 I273F probably damaging Het
Phactr3 T A 2: 178,278,901 N177K probably benign Het
Pik3c2b C T 1: 133,099,702 T1313I possibly damaging Het
Pikfyve C A 1: 65,235,033 D677E probably damaging Het
Poc1a T C 9: 106,288,010 F157L probably damaging Het
Prodh2 G T 7: 30,494,523 R185L possibly damaging Het
Rhd G A 4: 134,884,617 A249T probably damaging Het
Rtf2 A G 2: 172,445,332 Y57C probably damaging Het
Shmt1 A G 11: 60,794,899 S284P possibly damaging Het
Shpk T C 11: 73,199,535 V6A probably benign Het
Slc4a5 T C 6: 83,285,854 V661A probably benign Het
Spesp1 A T 9: 62,272,732 L298Q probably damaging Het
Tas1r2 C A 4: 139,660,009 Q231K probably benign Het
Tcp11l1 T C 2: 104,688,511 Y280C probably benign Het
Tnip1 T C 11: 54,910,799 probably benign Het
Topbp1 T A 9: 103,315,196 D295E probably benign Het
Unc79 C T 12: 103,112,138 L1521F probably damaging Het
Usp10 T C 8: 119,956,667 I759T probably benign Het
Vmn1r30 A T 6: 58,435,774 C24* probably null Het
Vmn2r104 T A 17: 20,030,081 I643F probably damaging Het
Wwc1 T A 11: 35,867,372 T716S probably damaging Het
Zfp949 C T 9: 88,569,484 T369M probably benign Het
Zhx3 A G 2: 160,780,018 V743A probably benign Het
Other mutations in Rcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02881:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02927:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02802:Rcc1 UTSW 4 132337756 missense probably benign 0.20
IGL02837:Rcc1 UTSW 4 132337756 missense probably benign 0.20
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0828:Rcc1 UTSW 4 132335825 unclassified probably benign
R1606:Rcc1 UTSW 4 132334776 unclassified probably null
R2155:Rcc1 UTSW 4 132338049 critical splice donor site probably null
R3721:Rcc1 UTSW 4 132337814 missense possibly damaging 0.46
R4633:Rcc1 UTSW 4 132335769 missense probably damaging 0.98
R4908:Rcc1 UTSW 4 132337753 missense probably damaging 1.00
R4936:Rcc1 UTSW 4 132335735 missense probably damaging 0.96
R5627:Rcc1 UTSW 4 132338143 missense probably damaging 0.98
R6088:Rcc1 UTSW 4 132332842 missense probably benign 0.00
R6197:Rcc1 UTSW 4 132337762 missense possibly damaging 0.58
R6456:Rcc1 UTSW 4 132334116 missense probably benign 0.10
R7127:Rcc1 UTSW 4 132334796 missense probably damaging 0.98
R7440:Rcc1 UTSW 4 132337799 missense probably damaging 0.97
R7529:Rcc1 UTSW 4 132334563 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGACAGGAGATACAGCACAC -3'
(R):5'- TGGGCCAGACATAGATTTGC -3'

Sequencing Primer
(F):5'- GCACACCAAGGAATTTGCTAG -3'
(R):5'- GGCCAGACATAGATTTGCATCCATG -3'
Posted On2016-10-06