Incidental Mutation 'R5461:Olfr615'
ID433022
Institutional Source Beutler Lab
Gene Symbol Olfr615
Ensembl Gene ENSMUSG00000073947
Gene Nameolfactory receptor 615
SynonymsGA_x6K02T2PBJ9-6284902-6285843, MOR19-2
MMRRC Submission 043023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5461 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103556079-103563798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103560573 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 32 (L32Q)
Ref Sequence ENSEMBL: ENSMUSP00000150166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098198] [ENSMUST00000106886] [ENSMUST00000214345] [ENSMUST00000214806] [ENSMUST00000215673] [ENSMUST00000217293]
Predicted Effect probably damaging
Transcript: ENSMUST00000098198
AA Change: L32Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095800
Gene: ENSMUSG00000073947
AA Change: L32Q

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.5e-105 PFAM
Pfam:7TM_GPCR_Srsx 36 253 8.5e-9 PFAM
Pfam:7tm_1 42 293 8.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106886
SMART Domains Protein: ENSMUSP00000102499
Gene: ENSMUSG00000047544

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:7tm_4 33 311 1.1e-116 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.2e-6 PFAM
Pfam:7tm_1 43 294 4.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214345
AA Change: L32Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000214806
Predicted Effect probably damaging
Transcript: ENSMUST00000215673
AA Change: L32Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000217293
Meta Mutation Damage Score 0.7394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,777 I405K possibly damaging Het
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Adgrg6 A T 10: 14,420,504 W1079R probably damaging Het
Arsa T C 15: 89,473,275 H495R probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Brsk2 T C 7: 141,987,906 L152P probably damaging Het
C8a T C 4: 104,815,845 probably benign Het
Ccdc177 G A 12: 80,758,042 A486V unknown Het
Cpa2 A G 6: 30,544,181 T38A probably benign Het
Crim1 T G 17: 78,237,807 C133G probably damaging Het
Dnah2 C T 11: 69,473,351 probably null Het
Ep400 G A 5: 110,676,684 Q2392* probably null Het
Exoc2 C T 13: 30,925,755 S210N possibly damaging Het
Gm7003 A G 12: 113,803,227 probably benign Het
Hydin A G 8: 110,519,231 K2192R probably damaging Het
Ica1l T C 1: 60,013,851 D176G probably damaging Het
Ints10 G A 8: 68,794,041 E8K possibly damaging Het
Itgb8 T C 12: 119,168,005 E635G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kng1 A G 16: 23,079,137 H429R probably benign Het
Mcm3 T C 1: 20,814,437 I281V probably benign Het
Msi1 T C 5: 115,441,391 S200P possibly damaging Het
Nat3 T C 8: 67,547,862 L131P probably damaging Het
Ncor2 T C 5: 125,027,113 E1752G probably damaging Het
Nnt C T 13: 119,368,595 A414T possibly damaging Het
Nrp2 C T 1: 62,747,211 Q292* probably null Het
Olfr552 G A 7: 102,604,408 G18D probably damaging Het
Otop1 A T 5: 38,299,715 I273F probably damaging Het
Phactr3 T A 2: 178,278,901 N177K probably benign Het
Pik3c2b C T 1: 133,099,702 T1313I possibly damaging Het
Pikfyve C A 1: 65,235,033 D677E probably damaging Het
Poc1a T C 9: 106,288,010 F157L probably damaging Het
Prodh2 G T 7: 30,494,523 R185L possibly damaging Het
Rcc1 T C 4: 132,334,186 I350M probably benign Het
Rhd G A 4: 134,884,617 A249T probably damaging Het
Rtf2 A G 2: 172,445,332 Y57C probably damaging Het
Shmt1 A G 11: 60,794,899 S284P possibly damaging Het
Shpk T C 11: 73,199,535 V6A probably benign Het
Slc4a5 T C 6: 83,285,854 V661A probably benign Het
Spesp1 A T 9: 62,272,732 L298Q probably damaging Het
Tas1r2 C A 4: 139,660,009 Q231K probably benign Het
Tcp11l1 T C 2: 104,688,511 Y280C probably benign Het
Tnip1 T C 11: 54,910,799 probably benign Het
Topbp1 T A 9: 103,315,196 D295E probably benign Het
Unc79 C T 12: 103,112,138 L1521F probably damaging Het
Usp10 T C 8: 119,956,667 I759T probably benign Het
Vmn1r30 A T 6: 58,435,774 C24* probably null Het
Vmn2r104 T A 17: 20,030,081 I643F probably damaging Het
Wwc1 T A 11: 35,867,372 T716S probably damaging Het
Zfp949 C T 9: 88,569,484 T369M probably benign Het
Zhx3 A G 2: 160,780,018 V743A probably benign Het
Other mutations in Olfr615
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Olfr615 APN 7 103561356 missense probably damaging 1.00
IGL01310:Olfr615 APN 7 103560801 missense probably benign
IGL01597:Olfr615 APN 7 103561142 missense possibly damaging 0.79
IGL01725:Olfr615 APN 7 103561075 nonsense probably null
IGL03291:Olfr615 APN 7 103560912 missense possibly damaging 0.93
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0055:Olfr615 UTSW 7 103561037 missense probably damaging 1.00
R0189:Olfr615 UTSW 7 103561082 missense probably benign 0.01
R0254:Olfr615 UTSW 7 103560622 nonsense probably null
R1395:Olfr615 UTSW 7 103561119 missense possibly damaging 0.92
R1781:Olfr615 UTSW 7 103560566 missense probably benign 0.34
R2866:Olfr615 UTSW 7 103560857 missense probably damaging 1.00
R2958:Olfr615 UTSW 7 103561305 missense possibly damaging 0.54
R3922:Olfr615 UTSW 7 103560705 missense probably benign 0.00
R4306:Olfr615 UTSW 7 103561172 nonsense probably null
R4306:Olfr615 UTSW 7 103561173 missense possibly damaging 0.50
R4818:Olfr615 UTSW 7 103560761 missense probably benign 0.07
R4907:Olfr615 UTSW 7 103561034 missense possibly damaging 0.85
R4993:Olfr615 UTSW 7 103561317 missense possibly damaging 0.63
R6225:Olfr615 UTSW 7 103561282 missense probably benign 0.01
R6621:Olfr615 UTSW 7 103560878 missense possibly damaging 0.93
R7174:Olfr615 UTSW 7 103561391 nonsense probably null
R7665:Olfr615 UTSW 7 103561316 missense probably benign 0.00
R7684:Olfr615 UTSW 7 103561218 missense probably benign 0.01
Z1088:Olfr615 UTSW 7 103561059 missense probably benign
Z1088:Olfr615 UTSW 7 103561390 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTGAATGTGACATTTAACGTTTGC -3'
(R):5'- CCTGAACCCATGGAAGAAGATG -3'

Sequencing Primer
(F):5'- CTTCTTTCCAGGGTTCAGTGACAG -3'
(R):5'- GGCAACTGTCAAATGCAATTTC -3'
Posted On2016-10-06