Incidental Mutation 'R5461:Nat3'
ID433024
Institutional Source Beutler Lab
Gene Symbol Nat3
Ensembl Gene ENSMUSG00000056426
Gene NameN-acetyltransferase 3
Synonyms
MMRRC Submission 043023-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5461 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location67523854-67548627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67547862 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 131 (L131P)
Ref Sequence ENSEMBL: ENSMUSP00000069359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070514]
Predicted Effect probably damaging
Transcript: ENSMUST00000070514
AA Change: L131P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069359
Gene: ENSMUSG00000056426
AA Change: L131P

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.6e-91 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,777 I405K possibly damaging Het
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Adgrg6 A T 10: 14,420,504 W1079R probably damaging Het
Arsa T C 15: 89,473,275 H495R probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Brsk2 T C 7: 141,987,906 L152P probably damaging Het
C8a T C 4: 104,815,845 probably benign Het
Ccdc177 G A 12: 80,758,042 A486V unknown Het
Cpa2 A G 6: 30,544,181 T38A probably benign Het
Crim1 T G 17: 78,237,807 C133G probably damaging Het
Dnah2 C T 11: 69,473,351 probably null Het
Ep400 G A 5: 110,676,684 Q2392* probably null Het
Exoc2 C T 13: 30,925,755 S210N possibly damaging Het
Gm7003 A G 12: 113,803,227 probably benign Het
Hydin A G 8: 110,519,231 K2192R probably damaging Het
Ica1l T C 1: 60,013,851 D176G probably damaging Het
Ints10 G A 8: 68,794,041 E8K possibly damaging Het
Itgb8 T C 12: 119,168,005 E635G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kng1 A G 16: 23,079,137 H429R probably benign Het
Mcm3 T C 1: 20,814,437 I281V probably benign Het
Msi1 T C 5: 115,441,391 S200P possibly damaging Het
Ncor2 T C 5: 125,027,113 E1752G probably damaging Het
Nnt C T 13: 119,368,595 A414T possibly damaging Het
Nrp2 C T 1: 62,747,211 Q292* probably null Het
Olfr552 G A 7: 102,604,408 G18D probably damaging Het
Olfr615 T A 7: 103,560,573 L32Q probably damaging Het
Otop1 A T 5: 38,299,715 I273F probably damaging Het
Phactr3 T A 2: 178,278,901 N177K probably benign Het
Pik3c2b C T 1: 133,099,702 T1313I possibly damaging Het
Pikfyve C A 1: 65,235,033 D677E probably damaging Het
Poc1a T C 9: 106,288,010 F157L probably damaging Het
Prodh2 G T 7: 30,494,523 R185L possibly damaging Het
Rcc1 T C 4: 132,334,186 I350M probably benign Het
Rhd G A 4: 134,884,617 A249T probably damaging Het
Rtf2 A G 2: 172,445,332 Y57C probably damaging Het
Shmt1 A G 11: 60,794,899 S284P possibly damaging Het
Shpk T C 11: 73,199,535 V6A probably benign Het
Slc4a5 T C 6: 83,285,854 V661A probably benign Het
Spesp1 A T 9: 62,272,732 L298Q probably damaging Het
Tas1r2 C A 4: 139,660,009 Q231K probably benign Het
Tcp11l1 T C 2: 104,688,511 Y280C probably benign Het
Tnip1 T C 11: 54,910,799 probably benign Het
Topbp1 T A 9: 103,315,196 D295E probably benign Het
Unc79 C T 12: 103,112,138 L1521F probably damaging Het
Usp10 T C 8: 119,956,667 I759T probably benign Het
Vmn1r30 A T 6: 58,435,774 C24* probably null Het
Vmn2r104 T A 17: 20,030,081 I643F probably damaging Het
Wwc1 T A 11: 35,867,372 T716S probably damaging Het
Zfp949 C T 9: 88,569,484 T369M probably benign Het
Zhx3 A G 2: 160,780,018 V743A probably benign Het
Other mutations in Nat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Nat3 APN 8 67547746 nonsense probably null
IGL03277:Nat3 APN 8 67547689 missense probably benign 0.11
IGL02802:Nat3 UTSW 8 67547508 missense probably benign 0.08
R0266:Nat3 UTSW 8 67547780 missense probably benign
R0842:Nat3 UTSW 8 67547997 missense probably benign 0.01
R5245:Nat3 UTSW 8 67548180 missense probably benign 0.09
R5892:Nat3 UTSW 8 67547938 missense probably benign 0.01
R6371:Nat3 UTSW 8 67524179 splice site probably null
R7523:Nat3 UTSW 8 67547574 missense probably damaging 0.99
R7587:Nat3 UTSW 8 67547574 missense probably damaging 0.99
R7677:Nat3 UTSW 8 67547487 missense probably damaging 1.00
R8052:Nat3 UTSW 8 67547826 missense possibly damaging 0.71
X0067:Nat3 UTSW 8 67548334 missense probably benign 0.09
Z1176:Nat3 UTSW 8 67547814 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGGTGGTGTCTTCAAGTCAACC -3'
(R):5'- TCGTTCGTGGTTCAAGAGTAAAAG -3'

Sequencing Primer
(F):5'- AAGTCAACCATCTTCTCTACTGGG -3'
(R):5'- TTTGTTCCAGGTACCAGG -3'
Posted On2016-10-06