Incidental Mutation 'R5461:Usp10'
ID433028
Institutional Source Beutler Lab
Gene Symbol Usp10
Ensembl Gene ENSMUSG00000031826
Gene Nameubiquitin specific peptidase 10
SynonymsUchrp, 2610014N07Rik
MMRRC Submission 043023-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5461 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119910360-119957560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119956667 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 759 (I759T)
Ref Sequence ENSEMBL: ENSMUSP00000104616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108982] [ENSMUST00000108988] [ENSMUST00000127664] [ENSMUST00000144458]
Predicted Effect probably benign
Transcript: ENSMUST00000108982
SMART Domains Protein: ENSMUSP00000104610
Gene: ENSMUSG00000031826

DomainStartEndE-ValueType
Pfam:UCH 9 113 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108988
AA Change: I759T

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104616
Gene: ENSMUSG00000031826
AA Change: I759T

DomainStartEndE-ValueType
low complexity region 117 131 N/A INTRINSIC
low complexity region 147 155 N/A INTRINSIC
Pfam:UCH 408 786 9.3e-48 PFAM
Pfam:UCH_1 409 764 4.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125066
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000134729
AA Change: S74P
SMART Domains Protein: ENSMUSP00000134182
Gene: ENSMUSG00000031826
AA Change: S74P

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143615
Predicted Effect probably benign
Transcript: ENSMUST00000144458
AA Change: I760T

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123590
Gene: ENSMUSG00000031826
AA Change: I760T

DomainStartEndE-ValueType
Pfam:PAM2 78 95 1.1e-7 PFAM
low complexity region 118 132 N/A INTRINSIC
low complexity region 148 156 N/A INTRINSIC
Pfam:UCH 409 787 1.2e-44 PFAM
Pfam:UCH_1 410 765 4.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148767
Meta Mutation Damage Score 0.6389 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in arsenite-induced stress granule formation, reactive oxygen species (ROS) production, and ROS-dependent apoptosis in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,777 I405K possibly damaging Het
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Adgrg6 A T 10: 14,420,504 W1079R probably damaging Het
Arsa T C 15: 89,473,275 H495R probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Brsk2 T C 7: 141,987,906 L152P probably damaging Het
C8a T C 4: 104,815,845 probably benign Het
Ccdc177 G A 12: 80,758,042 A486V unknown Het
Cpa2 A G 6: 30,544,181 T38A probably benign Het
Crim1 T G 17: 78,237,807 C133G probably damaging Het
Dnah2 C T 11: 69,473,351 probably null Het
Ep400 G A 5: 110,676,684 Q2392* probably null Het
Exoc2 C T 13: 30,925,755 S210N possibly damaging Het
Gm7003 A G 12: 113,803,227 probably benign Het
Hydin A G 8: 110,519,231 K2192R probably damaging Het
Ica1l T C 1: 60,013,851 D176G probably damaging Het
Ints10 G A 8: 68,794,041 E8K possibly damaging Het
Itgb8 T C 12: 119,168,005 E635G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kng1 A G 16: 23,079,137 H429R probably benign Het
Mcm3 T C 1: 20,814,437 I281V probably benign Het
Msi1 T C 5: 115,441,391 S200P possibly damaging Het
Nat3 T C 8: 67,547,862 L131P probably damaging Het
Ncor2 T C 5: 125,027,113 E1752G probably damaging Het
Nnt C T 13: 119,368,595 A414T possibly damaging Het
Nrp2 C T 1: 62,747,211 Q292* probably null Het
Olfr552 G A 7: 102,604,408 G18D probably damaging Het
Olfr615 T A 7: 103,560,573 L32Q probably damaging Het
Otop1 A T 5: 38,299,715 I273F probably damaging Het
Phactr3 T A 2: 178,278,901 N177K probably benign Het
Pik3c2b C T 1: 133,099,702 T1313I possibly damaging Het
Pikfyve C A 1: 65,235,033 D677E probably damaging Het
Poc1a T C 9: 106,288,010 F157L probably damaging Het
Prodh2 G T 7: 30,494,523 R185L possibly damaging Het
Rcc1 T C 4: 132,334,186 I350M probably benign Het
Rhd G A 4: 134,884,617 A249T probably damaging Het
Rtf2 A G 2: 172,445,332 Y57C probably damaging Het
Shmt1 A G 11: 60,794,899 S284P possibly damaging Het
Shpk T C 11: 73,199,535 V6A probably benign Het
Slc4a5 T C 6: 83,285,854 V661A probably benign Het
Spesp1 A T 9: 62,272,732 L298Q probably damaging Het
Tas1r2 C A 4: 139,660,009 Q231K probably benign Het
Tcp11l1 T C 2: 104,688,511 Y280C probably benign Het
Tnip1 T C 11: 54,910,799 probably benign Het
Topbp1 T A 9: 103,315,196 D295E probably benign Het
Unc79 C T 12: 103,112,138 L1521F probably damaging Het
Vmn1r30 A T 6: 58,435,774 C24* probably null Het
Vmn2r104 T A 17: 20,030,081 I643F probably damaging Het
Wwc1 T A 11: 35,867,372 T716S probably damaging Het
Zfp949 C T 9: 88,569,484 T369M probably benign Het
Zhx3 A G 2: 160,780,018 V743A probably benign Het
Other mutations in Usp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Usp10 APN 8 119948741 missense possibly damaging 0.95
IGL02444:Usp10 APN 8 119948693 missense possibly damaging 0.70
IGL02487:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02526:Usp10 APN 8 119948775 missense probably damaging 1.00
IGL02951:Usp10 APN 8 119947086 missense probably benign 0.01
IGL03003:Usp10 APN 8 119954810 missense possibly damaging 0.90
IGL03049:Usp10 APN 8 119956627 missense probably benign 0.01
PIT4585001:Usp10 UTSW 8 119954892 missense probably benign 0.02
R0090:Usp10 UTSW 8 119953196 nonsense probably null
R0329:Usp10 UTSW 8 119936557 nonsense probably null
R0550:Usp10 UTSW 8 119947801 missense probably damaging 0.98
R2349:Usp10 UTSW 8 119956709 makesense probably null
R4345:Usp10 UTSW 8 119954814 missense probably damaging 1.00
R4782:Usp10 UTSW 8 119941191 missense probably benign 0.03
R5182:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5184:Usp10 UTSW 8 119956681 missense possibly damaging 0.95
R5749:Usp10 UTSW 8 119941133 missense probably damaging 0.99
R5873:Usp10 UTSW 8 119947092 missense possibly damaging 0.60
R5935:Usp10 UTSW 8 119947089 missense possibly damaging 0.74
R6242:Usp10 UTSW 8 119941838 missense probably benign 0.01
R6362:Usp10 UTSW 8 119941316 missense probably benign 0.00
R6608:Usp10 UTSW 8 119948422 missense probably benign 0.06
R6774:Usp10 UTSW 8 119951972 missense probably benign
R7148:Usp10 UTSW 8 119936550 missense possibly damaging 0.47
R7164:Usp10 UTSW 8 119942108 missense probably damaging 1.00
R7238:Usp10 UTSW 8 119941544 missense probably benign
R7310:Usp10 UTSW 8 119941605 missense possibly damaging 0.89
R7792:Usp10 UTSW 8 119952001 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGTGTCCACCTGAGTCAGTAGC -3'
(R):5'- CTACAGAGCCACTAGAGAGGTG -3'

Sequencing Primer
(F):5'- ACCTGAGTCAGTAGCCTGCAG -3'
(R):5'- CACTAGAGAGGTGGGTAGTGAGTG -3'
Posted On2016-10-06