Incidental Mutation 'R5461:Vmn2r104'
ID 433049
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Name vomeronasal 2, receptor 104
Synonyms V2r7
MMRRC Submission 043023-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5461 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20029425-20048205 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20030081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 643 (I643F)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
AlphaFold E9Q2J5
Predicted Effect probably damaging
Transcript: ENSMUST00000168050
AA Change: I643F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: I643F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,736,777 I405K possibly damaging Het
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Adgrg6 A T 10: 14,420,504 W1079R probably damaging Het
Arsa T C 15: 89,473,275 H495R probably benign Het
Bptf T C 11: 107,061,764 T2088A probably damaging Het
Brsk2 T C 7: 141,987,906 L152P probably damaging Het
C8a T C 4: 104,815,845 probably benign Het
Ccdc177 G A 12: 80,758,042 A486V unknown Het
Cpa2 A G 6: 30,544,181 T38A probably benign Het
Crim1 T G 17: 78,237,807 C133G probably damaging Het
Dnah2 C T 11: 69,473,351 probably null Het
Ep400 G A 5: 110,676,684 Q2392* probably null Het
Exoc2 C T 13: 30,925,755 S210N possibly damaging Het
Gm7003 A G 12: 113,803,227 probably benign Het
Hydin A G 8: 110,519,231 K2192R probably damaging Het
Ica1l T C 1: 60,013,851 D176G probably damaging Het
Ints10 G A 8: 68,794,041 E8K possibly damaging Het
Itgb8 T C 12: 119,168,005 E635G probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Kng1 A G 16: 23,079,137 H429R probably benign Het
Mcm3 T C 1: 20,814,437 I281V probably benign Het
Msi1 T C 5: 115,441,391 S200P possibly damaging Het
Nat3 T C 8: 67,547,862 L131P probably damaging Het
Ncor2 T C 5: 125,027,113 E1752G probably damaging Het
Nnt C T 13: 119,368,595 A414T possibly damaging Het
Nrp2 C T 1: 62,747,211 Q292* probably null Het
Olfr552 G A 7: 102,604,408 G18D probably damaging Het
Olfr615 T A 7: 103,560,573 L32Q probably damaging Het
Otop1 A T 5: 38,299,715 I273F probably damaging Het
Phactr3 T A 2: 178,278,901 N177K probably benign Het
Pik3c2b C T 1: 133,099,702 T1313I possibly damaging Het
Pikfyve C A 1: 65,235,033 D677E probably damaging Het
Poc1a T C 9: 106,288,010 F157L probably damaging Het
Prodh2 G T 7: 30,494,523 R185L possibly damaging Het
Rcc1 T C 4: 132,334,186 I350M probably benign Het
Rhd G A 4: 134,884,617 A249T probably damaging Het
Rtf2 A G 2: 172,445,332 Y57C probably damaging Het
Shmt1 A G 11: 60,794,899 S284P possibly damaging Het
Shpk T C 11: 73,199,535 V6A probably benign Het
Slc4a5 T C 6: 83,285,854 V661A probably benign Het
Spesp1 A T 9: 62,272,732 L298Q probably damaging Het
Tas1r2 C A 4: 139,660,009 Q231K probably benign Het
Tcp11l1 T C 2: 104,688,511 Y280C probably benign Het
Tnip1 T C 11: 54,910,799 probably benign Het
Topbp1 T A 9: 103,315,196 D295E probably benign Het
Unc79 C T 12: 103,112,138 L1521F probably damaging Het
Usp10 T C 8: 119,956,667 I759T probably benign Het
Vmn1r30 A T 6: 58,435,774 C24* probably null Het
Wwc1 T A 11: 35,867,372 T716S probably damaging Het
Zfp949 C T 9: 88,569,484 T369M probably benign Het
Zhx3 A G 2: 160,780,018 V743A probably benign Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20048002 nonsense probably null
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20048193 missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030110 missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20041709 missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20042726 missense probably benign
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20030221 missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20030203 missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20040778 missense possibly damaging 0.55
R8691:Vmn2r104 UTSW 17 20041848 missense probably damaging 0.98
R8795:Vmn2r104 UTSW 17 20042726 missense probably benign
R8900:Vmn2r104 UTSW 17 20041662 missense probably damaging 0.99
R8913:Vmn2r104 UTSW 17 20029706 missense probably damaging 1.00
R9180:Vmn2r104 UTSW 17 20042825 missense probably benign 0.00
R9199:Vmn2r104 UTSW 17 20041835 missense probably damaging 0.99
R9282:Vmn2r104 UTSW 17 20040836 missense probably damaging 1.00
R9303:Vmn2r104 UTSW 17 20048177 missense possibly damaging 0.90
R9305:Vmn2r104 UTSW 17 20048177 missense possibly damaging 0.90
R9322:Vmn2r104 UTSW 17 20042825 missense probably benign 0.00
R9325:Vmn2r104 UTSW 17 20048171 missense possibly damaging 0.95
R9414:Vmn2r104 UTSW 17 20029988 missense probably damaging 0.99
R9785:Vmn2r104 UTSW 17 20048147 missense probably benign
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAGCTGGATCAGTGTGC -3'
(R):5'- CTTTCTGGCCTATGAAGACCCC -3'

Sequencing Primer
(F):5'- AGGAATGATGTATCTTGGACCCC -3'
(R):5'- CCTTGGGGATGGCTCTAGC -3'
Posted On 2016-10-06