Incidental Mutation 'R5461:Vmn2r104'
ID 433049
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Name vomeronasal 2, receptor 104
Synonyms V2r7
MMRRC Submission 043023-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R5461 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 20249687-20268467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20250343 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 643 (I643F)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
AlphaFold E9Q2J5
Predicted Effect probably damaging
Transcript: ENSMUST00000168050
AA Change: I643F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: I643F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,884,643 (GRCm39) I405K possibly damaging Het
4930562C15Rik G A 16: 4,682,227 (GRCm39) G180E probably damaging Het
Adgrg6 A T 10: 14,296,248 (GRCm39) W1079R probably damaging Het
Arsa T C 15: 89,357,478 (GRCm39) H495R probably benign Het
Bptf T C 11: 106,952,590 (GRCm39) T2088A probably damaging Het
Brsk2 T C 7: 141,541,643 (GRCm39) L152P probably damaging Het
C8a T C 4: 104,673,042 (GRCm39) probably benign Het
Ccdc177 G A 12: 80,804,816 (GRCm39) A486V unknown Het
Cpa2 A G 6: 30,544,180 (GRCm39) T38A probably benign Het
Crim1 T G 17: 78,545,236 (GRCm39) C133G probably damaging Het
Dnah2 C T 11: 69,364,177 (GRCm39) probably null Het
Ep400 G A 5: 110,824,550 (GRCm39) Q2392* probably null Het
Exoc2 C T 13: 31,109,738 (GRCm39) S210N possibly damaging Het
Gm7003 A G 12: 113,766,847 (GRCm39) probably benign Het
Hydin A G 8: 111,245,863 (GRCm39) K2192R probably damaging Het
Ica1l T C 1: 60,053,010 (GRCm39) D176G probably damaging Het
Ints10 G A 8: 69,246,693 (GRCm39) E8K possibly damaging Het
Itgb8 T C 12: 119,131,740 (GRCm39) E635G probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Kng1 A G 16: 22,897,887 (GRCm39) H429R probably benign Het
Mcm3 T C 1: 20,884,661 (GRCm39) I281V probably benign Het
Msi1 T C 5: 115,579,450 (GRCm39) S200P possibly damaging Het
Nat3 T C 8: 68,000,514 (GRCm39) L131P probably damaging Het
Ncor2 T C 5: 125,104,177 (GRCm39) E1752G probably damaging Het
Nnt C T 13: 119,505,131 (GRCm39) A414T possibly damaging Het
Nrp2 C T 1: 62,786,370 (GRCm39) Q292* probably null Het
Or51ah3 T A 7: 103,209,780 (GRCm39) L32Q probably damaging Het
Or52k2 G A 7: 102,253,615 (GRCm39) G18D probably damaging Het
Otop1 A T 5: 38,457,059 (GRCm39) I273F probably damaging Het
Phactr3 T A 2: 177,920,694 (GRCm39) N177K probably benign Het
Pik3c2b C T 1: 133,027,440 (GRCm39) T1313I possibly damaging Het
Pikfyve C A 1: 65,274,192 (GRCm39) D677E probably damaging Het
Poc1a T C 9: 106,165,209 (GRCm39) F157L probably damaging Het
Prodh2 G T 7: 30,193,948 (GRCm39) R185L possibly damaging Het
Rcc1 T C 4: 132,061,497 (GRCm39) I350M probably benign Het
Rhd G A 4: 134,611,928 (GRCm39) A249T probably damaging Het
Rtf2 A G 2: 172,287,252 (GRCm39) Y57C probably damaging Het
Shmt1 A G 11: 60,685,725 (GRCm39) S284P possibly damaging Het
Shpk T C 11: 73,090,361 (GRCm39) V6A probably benign Het
Slc4a5 T C 6: 83,262,836 (GRCm39) V661A probably benign Het
Spesp1 A T 9: 62,180,014 (GRCm39) L298Q probably damaging Het
Tas1r2 C A 4: 139,387,320 (GRCm39) Q231K probably benign Het
Tcp11l1 T C 2: 104,518,856 (GRCm39) Y280C probably benign Het
Tnip1 T C 11: 54,801,625 (GRCm39) probably benign Het
Topbp1 T A 9: 103,192,395 (GRCm39) D295E probably benign Het
Unc79 C T 12: 103,078,397 (GRCm39) L1521F probably damaging Het
Usp10 T C 8: 120,683,406 (GRCm39) I759T probably benign Het
Vmn1r30 A T 6: 58,412,759 (GRCm39) C24* probably null Het
Wwc1 T A 11: 35,758,199 (GRCm39) T716S probably damaging Het
Zfp949 C T 9: 88,451,537 (GRCm39) T369M probably benign Het
Zhx3 A G 2: 160,621,938 (GRCm39) V743A probably benign Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20,258,501 (GRCm39) missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20,268,358 (GRCm39) missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20,263,055 (GRCm39) missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20,263,158 (GRCm39) missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20,260,930 (GRCm39) missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20,250,187 (GRCm39) missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20,262,056 (GRCm39) nonsense probably null
IGL02305:Vmn2r104 APN 17 20,263,118 (GRCm39) missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20,263,048 (GRCm39) missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20,263,083 (GRCm39) missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20,249,866 (GRCm39) missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20,262,075 (GRCm39) missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20,250,069 (GRCm39) missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20,249,889 (GRCm39) missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20,268,264 (GRCm39) nonsense probably null
R0709:Vmn2r104 UTSW 17 20,263,166 (GRCm39) missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20,262,987 (GRCm39) missense probably benign
R1575:Vmn2r104 UTSW 17 20,262,477 (GRCm39) missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20,262,497 (GRCm39) missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20,261,031 (GRCm39) missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20,262,313 (GRCm39) missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20,250,083 (GRCm39) missense probably benign 0.05
R2859:Vmn2r104 UTSW 17 20,268,455 (GRCm39) missense possibly damaging 0.82
R3701:Vmn2r104 UTSW 17 20,249,818 (GRCm39) missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20,250,183 (GRCm39) missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20,250,147 (GRCm39) missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20,262,503 (GRCm39) missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20,268,443 (GRCm39) missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20,261,030 (GRCm39) nonsense probably null
R4911:Vmn2r104 UTSW 17 20,250,288 (GRCm39) missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20,258,528 (GRCm39) missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20,262,146 (GRCm39) missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20,250,163 (GRCm39) missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20,250,450 (GRCm39) missense probably damaging 0.97
R5683:Vmn2r104 UTSW 17 20,260,981 (GRCm39) nonsense probably null
R5795:Vmn2r104 UTSW 17 20,250,372 (GRCm39) missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20,250,544 (GRCm39) missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20,249,733 (GRCm39) missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20,261,970 (GRCm39) missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20,249,747 (GRCm39) missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20,258,573 (GRCm39) missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20,261,909 (GRCm39) missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20,250,507 (GRCm39) missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20,261,829 (GRCm39) missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20,249,848 (GRCm39) missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20,262,487 (GRCm39) missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20,250,358 (GRCm39) missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20,261,088 (GRCm39) missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20,249,737 (GRCm39) missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20,249,791 (GRCm39) missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20,261,971 (GRCm39) missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8031:Vmn2r104 UTSW 17 20,263,048 (GRCm39) missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20,250,483 (GRCm39) missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20,250,465 (GRCm39) missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20,261,040 (GRCm39) missense possibly damaging 0.55
R8691:Vmn2r104 UTSW 17 20,262,110 (GRCm39) missense probably damaging 0.98
R8795:Vmn2r104 UTSW 17 20,262,988 (GRCm39) missense probably benign
R8900:Vmn2r104 UTSW 17 20,261,924 (GRCm39) missense probably damaging 0.99
R8913:Vmn2r104 UTSW 17 20,249,968 (GRCm39) missense probably damaging 1.00
R9180:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9199:Vmn2r104 UTSW 17 20,262,097 (GRCm39) missense probably damaging 0.99
R9282:Vmn2r104 UTSW 17 20,261,098 (GRCm39) missense probably damaging 1.00
R9303:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9305:Vmn2r104 UTSW 17 20,268,439 (GRCm39) missense possibly damaging 0.90
R9322:Vmn2r104 UTSW 17 20,263,087 (GRCm39) missense probably benign 0.00
R9325:Vmn2r104 UTSW 17 20,268,433 (GRCm39) missense possibly damaging 0.95
R9414:Vmn2r104 UTSW 17 20,250,250 (GRCm39) missense probably damaging 0.99
R9785:Vmn2r104 UTSW 17 20,268,409 (GRCm39) missense probably benign
RF007:Vmn2r104 UTSW 17 20,268,302 (GRCm39) missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20,250,051 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAAGCTGGATCAGTGTGC -3'
(R):5'- CTTTCTGGCCTATGAAGACCCC -3'

Sequencing Primer
(F):5'- AGGAATGATGTATCTTGGACCCC -3'
(R):5'- CCTTGGGGATGGCTCTAGC -3'
Posted On 2016-10-06