Incidental Mutation 'R5462:E2f2'
ID433059
Institutional Source Beutler Lab
Gene Symbol E2f2
Ensembl Gene ENSMUSG00000018983
Gene NameE2F transcription factor 2
Synonyms
MMRRC Submission 043024-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R5462 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136172394-136196057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136172913 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 45 (T45S)
Ref Sequence ENSEMBL: ENSMUSP00000050047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061721]
Predicted Effect probably benign
Transcript: ENSMUST00000061721
AA Change: T45S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000050047
Gene: ENSMUSG00000018983
AA Change: T45S

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
E2F_TDP 131 196 2.93e-32 SMART
Pfam:E2F_CC-MB 212 306 3.1e-38 PFAM
low complexity region 348 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F1 and E2F3, have an additional cyclin binding domain. This protein binds specifically to retinoblastoma protein pRB in a cell-cycle dependent manner, and it exhibits overall 46% amino acid identity to E2F1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death with signs of inflammatory and autoimmune disorders such as increased memory T cells, enlarged spleen, glomerulonephritis, inflammed liver, inflammed lung, increased double stranded DNA antibodies, hair loss, and erythema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
4933412E24Rik A G 15: 60,015,068 F508L probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Amz1 A G 5: 140,748,221 Y184C probably damaging Het
Calm3 A T 7: 16,917,694 D23E possibly damaging Het
Cep112 T A 11: 108,518,744 N479K probably damaging Het
Csmd1 A C 8: 15,961,486 N2522K probably benign Het
D3Ertd254e C T 3: 36,165,820 T664I possibly damaging Het
Dhx30 A G 9: 110,100,974 L18P probably damaging Het
Grk3 T C 5: 112,969,208 Y67C probably damaging Het
Htt T A 5: 34,885,507 C2290* probably null Het
Igsf10 T C 3: 59,325,754 T1853A probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mast2 A G 4: 116,307,458 L1587P probably damaging Het
Mdn1 A G 4: 32,720,897 N2337D probably benign Het
Mettl3 T C 14: 52,299,879 Q182R probably damaging Het
Mterf1b A G 5: 4,196,541 S61G probably benign Het
Mycbp2 T C 14: 103,200,126 Y2100C probably damaging Het
Nt5m T A 11: 59,874,559 W138R probably damaging Het
Olfr998 A G 2: 85,591,296 Y252C probably damaging Het
Prex1 A G 2: 166,644,808 Y114H probably benign Het
Rasa2 A T 9: 96,571,918 S322T probably damaging Het
Sis A T 3: 72,949,838 D373E probably damaging Het
Snx29 A T 16: 11,511,012 M552L possibly damaging Het
Sptbn1 G T 11: 30,100,520 F2356L possibly damaging Het
Tbc1d10c G T 19: 4,188,053 Q241K probably benign Het
Vmn1r222 A G 13: 23,232,875 I56T probably benign Het
Vmn2r111 T C 17: 22,548,257 Y753C probably damaging Het
Vmn2r37 A G 7: 9,217,974 W297R probably damaging Het
Wdr66 T C 5: 123,298,632 probably null Het
Zfp651 G T 9: 121,767,663 R695L probably damaging Het
Other mutations in E2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:E2f2 APN 4 136180417 nonsense probably null
IGL02078:E2f2 APN 4 136193012 missense probably damaging 1.00
IGL02112:E2f2 APN 4 136192834 missense probably benign 0.08
IGL02123:E2f2 APN 4 136172848 missense probably benign 0.00
R0398:E2f2 UTSW 4 136180544 missense probably damaging 1.00
R1594:E2f2 UTSW 4 136186830 missense possibly damaging 0.85
R4729:E2f2 UTSW 4 136184449 missense probably damaging 0.99
R5092:E2f2 UTSW 4 136186937 missense probably benign 0.04
R5184:E2f2 UTSW 4 136184440 missense possibly damaging 0.95
R5987:E2f2 UTSW 4 136172934 missense probably benign 0.00
R6237:E2f2 UTSW 4 136178485 missense possibly damaging 0.48
R7678:E2f2 UTSW 4 136192826 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTCCGAGTGGCGATCTCC -3'
(R):5'- CCAGCTGTAATCAAGCCGTAG -3'

Sequencing Primer
(F):5'- AGTGGCGATCTCCGAGCTC -3'
(R):5'- GCGTCCCAAGCACCCTCTC -3'
Posted On2016-10-06