Incidental Mutation 'R5462:E2f2'
ID 433059
Institutional Source Beutler Lab
Gene Symbol E2f2
Ensembl Gene ENSMUSG00000018983
Gene Name E2F transcription factor 2
Synonyms
MMRRC Submission 043024-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.440) question?
Stock # R5462 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 135899705-135923368 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 135900224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 45 (T45S)
Ref Sequence ENSEMBL: ENSMUSP00000050047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061721]
AlphaFold P56931
Predicted Effect probably benign
Transcript: ENSMUST00000061721
AA Change: T45S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000050047
Gene: ENSMUSG00000018983
AA Change: T45S

DomainStartEndE-ValueType
low complexity region 41 54 N/A INTRINSIC
E2F_TDP 131 196 2.93e-32 SMART
Pfam:E2F_CC-MB 212 306 3.1e-38 PFAM
low complexity region 348 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F1 and E2F3, have an additional cyclin binding domain. This protein binds specifically to retinoblastoma protein pRB in a cell-cycle dependent manner, and it exhibits overall 46% amino acid identity to E2F1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death with signs of inflammatory and autoimmune disorders such as increased memory T cells, enlarged spleen, glomerulonephritis, inflammed liver, inflammed lung, increased double stranded DNA antibodies, hair loss, and erythema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,682,227 (GRCm39) G180E probably damaging Het
4933412E24Rik A G 15: 59,886,917 (GRCm39) F508L probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Amz1 A G 5: 140,733,976 (GRCm39) Y184C probably damaging Het
Calm3 A T 7: 16,651,619 (GRCm39) D23E possibly damaging Het
Cep112 T A 11: 108,409,570 (GRCm39) N479K probably damaging Het
Cfap251 T C 5: 123,436,695 (GRCm39) probably null Het
Csmd1 A C 8: 16,011,486 (GRCm39) N2522K probably benign Het
Dhx30 A G 9: 109,930,042 (GRCm39) L18P probably damaging Het
Grk3 T C 5: 113,117,074 (GRCm39) Y67C probably damaging Het
Htt T A 5: 35,042,851 (GRCm39) C2290* probably null Het
Igsf10 T C 3: 59,233,175 (GRCm39) T1853A probably damaging Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Mast2 A G 4: 116,164,655 (GRCm39) L1587P probably damaging Het
Mdn1 A G 4: 32,720,897 (GRCm39) N2337D probably benign Het
Mettl3 T C 14: 52,537,336 (GRCm39) Q182R probably damaging Het
Mterf1b A G 5: 4,246,541 (GRCm39) S61G probably benign Het
Mycbp2 T C 14: 103,437,562 (GRCm39) Y2100C probably damaging Het
Nt5m T A 11: 59,765,385 (GRCm39) W138R probably damaging Het
Or5g29 A G 2: 85,421,640 (GRCm39) Y252C probably damaging Het
Prex1 A G 2: 166,486,728 (GRCm39) Y114H probably benign Het
Rasa2 A T 9: 96,453,971 (GRCm39) S322T probably damaging Het
Sis A T 3: 72,857,171 (GRCm39) D373E probably damaging Het
Snx29 A T 16: 11,328,876 (GRCm39) M552L possibly damaging Het
Sptbn1 G T 11: 30,050,520 (GRCm39) F2356L possibly damaging Het
Tbc1d10c G T 19: 4,238,052 (GRCm39) Q241K probably benign Het
Vmn1r222 A G 13: 23,417,045 (GRCm39) I56T probably benign Het
Vmn2r111 T C 17: 22,767,238 (GRCm39) Y753C probably damaging Het
Vmn2r37 A G 7: 9,220,973 (GRCm39) W297R probably damaging Het
Zbtb47 G T 9: 121,596,729 (GRCm39) R695L probably damaging Het
Zfp267 C T 3: 36,219,969 (GRCm39) T664I possibly damaging Het
Other mutations in E2f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:E2f2 APN 4 135,907,728 (GRCm39) nonsense probably null
IGL02078:E2f2 APN 4 135,920,323 (GRCm39) missense probably damaging 1.00
IGL02112:E2f2 APN 4 135,920,145 (GRCm39) missense probably benign 0.08
IGL02123:E2f2 APN 4 135,900,159 (GRCm39) missense probably benign 0.00
R0398:E2f2 UTSW 4 135,907,855 (GRCm39) missense probably damaging 1.00
R1594:E2f2 UTSW 4 135,914,141 (GRCm39) missense possibly damaging 0.85
R4729:E2f2 UTSW 4 135,911,760 (GRCm39) missense probably damaging 0.99
R5092:E2f2 UTSW 4 135,914,248 (GRCm39) missense probably benign 0.04
R5184:E2f2 UTSW 4 135,911,751 (GRCm39) missense possibly damaging 0.95
R5987:E2f2 UTSW 4 135,900,245 (GRCm39) missense probably benign 0.00
R6237:E2f2 UTSW 4 135,905,796 (GRCm39) missense possibly damaging 0.48
R7678:E2f2 UTSW 4 135,920,137 (GRCm39) nonsense probably null
R8247:E2f2 UTSW 4 135,900,126 (GRCm39) missense possibly damaging 0.76
R8261:E2f2 UTSW 4 135,911,791 (GRCm39) synonymous silent
R9147:E2f2 UTSW 4 135,908,595 (GRCm39) critical splice acceptor site probably null
R9148:E2f2 UTSW 4 135,908,595 (GRCm39) critical splice acceptor site probably null
R9606:E2f2 UTSW 4 135,911,743 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTCCGAGTGGCGATCTCC -3'
(R):5'- CCAGCTGTAATCAAGCCGTAG -3'

Sequencing Primer
(F):5'- AGTGGCGATCTCCGAGCTC -3'
(R):5'- GCGTCCCAAGCACCCTCTC -3'
Posted On 2016-10-06