Incidental Mutation 'R5462:Acyp2'
ID433074
Institutional Source Beutler Lab
Gene Symbol Acyp2
Ensembl Gene ENSMUSG00000060923
Gene Nameacylphosphatase 2, muscle type
Synonyms
MMRRC Submission 043024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5462 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30505991-30649587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30506354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 98 (E98K)
Ref Sequence ENSEMBL: ENSMUSP00000074195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074613
AA Change: E98K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074195
Gene: ENSMUSG00000060923
AA Change: E98K

DomainStartEndE-ValueType
Pfam:Acylphosphatase 10 105 1.5e-26 PFAM
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acylphosphatase can hydrolyze the phosphoenzyme intermediate of different membrane pumps, particularly the Ca2+/Mg2+-ATPase from sarcoplasmic reticulum of skeletal muscle. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase on the basis of their tissue localization. This gene encodes the muscle-type isoform (MT). An increase of the MT isoform is associated with muscle differentiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
4933412E24Rik A G 15: 60,015,068 F508L probably benign Het
Amz1 A G 5: 140,748,221 Y184C probably damaging Het
Calm3 A T 7: 16,917,694 D23E possibly damaging Het
Cep112 T A 11: 108,518,744 N479K probably damaging Het
Csmd1 A C 8: 15,961,486 N2522K probably benign Het
D3Ertd254e C T 3: 36,165,820 T664I possibly damaging Het
Dhx30 A G 9: 110,100,974 L18P probably damaging Het
E2f2 A T 4: 136,172,913 T45S probably benign Het
Grk3 T C 5: 112,969,208 Y67C probably damaging Het
Htt T A 5: 34,885,507 C2290* probably null Het
Igsf10 T C 3: 59,325,754 T1853A probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mast2 A G 4: 116,307,458 L1587P probably damaging Het
Mdn1 A G 4: 32,720,897 N2337D probably benign Het
Mettl3 T C 14: 52,299,879 Q182R probably damaging Het
Mterf1b A G 5: 4,196,541 S61G probably benign Het
Mycbp2 T C 14: 103,200,126 Y2100C probably damaging Het
Nt5m T A 11: 59,874,559 W138R probably damaging Het
Olfr998 A G 2: 85,591,296 Y252C probably damaging Het
Prex1 A G 2: 166,644,808 Y114H probably benign Het
Rasa2 A T 9: 96,571,918 S322T probably damaging Het
Sis A T 3: 72,949,838 D373E probably damaging Het
Snx29 A T 16: 11,511,012 M552L possibly damaging Het
Sptbn1 G T 11: 30,100,520 F2356L possibly damaging Het
Tbc1d10c G T 19: 4,188,053 Q241K probably benign Het
Vmn1r222 A G 13: 23,232,875 I56T probably benign Het
Vmn2r111 T C 17: 22,548,257 Y753C probably damaging Het
Vmn2r37 A G 7: 9,217,974 W297R probably damaging Het
Wdr66 T C 5: 123,298,632 probably null Het
Zfp651 G T 9: 121,767,663 R695L probably damaging Het
Other mutations in Acyp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01587:Acyp2 APN 11 30506362 missense probably benign 0.07
IGL02365:Acyp2 APN 11 30649318 missense probably damaging 1.00
R1470:Acyp2 UTSW 11 30506452 splice site probably benign
R2419:Acyp2 UTSW 11 30632316 missense probably benign 0.20
R5389:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5393:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5423:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5425:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5426:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5460:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5464:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5560:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5561:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5602:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5826:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5901:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5902:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R5999:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6046:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6066:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6107:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6128:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6196:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
R6198:Acyp2 UTSW 11 30506354 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGCTTGCTAAAACATAGGTGAG -3'
(R):5'- GAGCAAGGTAATACTGACCTTGAAG -3'

Sequencing Primer
(F):5'- AGGTGAGTAAATGTTTTCAGTTTCAG -3'
(R):5'- GGTAATACTGACCTTGAAGAGTTTG -3'
Posted On2016-10-06