Incidental Mutation 'R5462:Vmn1r222'
ID433079
Institutional Source Beutler Lab
Gene Symbol Vmn1r222
Ensembl Gene ENSMUSG00000061022
Gene Namevomeronasal 1 receptor 222
SynonymsV1rh16
MMRRC Submission 043024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5462 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23232066-23233119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23232875 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 56 (I56T)
Ref Sequence ENSEMBL: ENSMUSP00000076365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077116]
Predicted Effect probably benign
Transcript: ENSMUST00000077116
AA Change: I56T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000076365
Gene: ENSMUSG00000061022
AA Change: I56T

DomainStartEndE-ValueType
Pfam:V1R 32 297 3.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225143
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
4933412E24Rik A G 15: 60,015,068 F508L probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Amz1 A G 5: 140,748,221 Y184C probably damaging Het
Calm3 A T 7: 16,917,694 D23E possibly damaging Het
Cep112 T A 11: 108,518,744 N479K probably damaging Het
Csmd1 A C 8: 15,961,486 N2522K probably benign Het
D3Ertd254e C T 3: 36,165,820 T664I possibly damaging Het
Dhx30 A G 9: 110,100,974 L18P probably damaging Het
E2f2 A T 4: 136,172,913 T45S probably benign Het
Grk3 T C 5: 112,969,208 Y67C probably damaging Het
Htt T A 5: 34,885,507 C2290* probably null Het
Igsf10 T C 3: 59,325,754 T1853A probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mast2 A G 4: 116,307,458 L1587P probably damaging Het
Mdn1 A G 4: 32,720,897 N2337D probably benign Het
Mettl3 T C 14: 52,299,879 Q182R probably damaging Het
Mterf1b A G 5: 4,196,541 S61G probably benign Het
Mycbp2 T C 14: 103,200,126 Y2100C probably damaging Het
Nt5m T A 11: 59,874,559 W138R probably damaging Het
Olfr998 A G 2: 85,591,296 Y252C probably damaging Het
Prex1 A G 2: 166,644,808 Y114H probably benign Het
Rasa2 A T 9: 96,571,918 S322T probably damaging Het
Sis A T 3: 72,949,838 D373E probably damaging Het
Snx29 A T 16: 11,511,012 M552L possibly damaging Het
Sptbn1 G T 11: 30,100,520 F2356L possibly damaging Het
Tbc1d10c G T 19: 4,188,053 Q241K probably benign Het
Vmn2r111 T C 17: 22,548,257 Y753C probably damaging Het
Vmn2r37 A G 7: 9,217,974 W297R probably damaging Het
Wdr66 T C 5: 123,298,632 probably null Het
Zfp651 G T 9: 121,767,663 R695L probably damaging Het
Other mutations in Vmn1r222
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Vmn1r222 APN 13 23232889 missense probably benign 0.45
IGL01960:Vmn1r222 APN 13 23232145 missense probably benign 0.00
IGL02082:Vmn1r222 APN 13 23232329 missense probably damaging 1.00
IGL02616:Vmn1r222 APN 13 23232141 missense possibly damaging 0.73
IGL03155:Vmn1r222 APN 13 23232693 missense probably damaging 1.00
IGL03333:Vmn1r222 APN 13 23233007 missense probably benign 0.18
IGL03391:Vmn1r222 APN 13 23232462 missense possibly damaging 0.94
R0137:Vmn1r222 UTSW 13 23232804 missense probably damaging 1.00
R1584:Vmn1r222 UTSW 13 23232762 missense probably damaging 1.00
R2352:Vmn1r222 UTSW 13 23232513 missense probably benign 0.35
R3079:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3080:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3963:Vmn1r222 UTSW 13 23232932 missense probably benign 0.01
R4448:Vmn1r222 UTSW 13 23232293 missense probably benign 0.11
R4448:Vmn1r222 UTSW 13 23232660 missense probably damaging 0.99
R4979:Vmn1r222 UTSW 13 23232432 missense possibly damaging 0.78
R5054:Vmn1r222 UTSW 13 23232731 missense probably damaging 0.98
R5182:Vmn1r222 UTSW 13 23232497 missense probably damaging 1.00
R5230:Vmn1r222 UTSW 13 23233002 missense probably benign
R5611:Vmn1r222 UTSW 13 23232573 missense probably damaging 1.00
R5677:Vmn1r222 UTSW 13 23232780 missense probably damaging 1.00
R6298:Vmn1r222 UTSW 13 23232795 missense probably benign 0.15
R6655:Vmn1r222 UTSW 13 23232716 missense probably damaging 1.00
R6748:Vmn1r222 UTSW 13 23232947 missense probably benign 0.00
R6912:Vmn1r222 UTSW 13 23232204 missense probably benign 0.44
R7663:Vmn1r222 UTSW 13 23232431 missense possibly damaging 0.78
R7764:Vmn1r222 UTSW 13 23232359 missense probably damaging 1.00
Z1177:Vmn1r222 UTSW 13 23232460 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGGGACTGATGATGATGGCC -3'
(R):5'- TGCAAAACTGACCCTTTCTTG -3'

Sequencing Primer
(F):5'- ACTGATGATGATGGCCTGGACC -3'
(R):5'- ACTGACCCTTTCTTGAAAAAGTC -3'
Posted On2016-10-06