Incidental Mutation 'R5462:4933412E24Rik'
ID433082
Institutional Source Beutler Lab
Gene Symbol 4933412E24Rik
Ensembl Gene ENSMUSG00000071749
Gene NameRIKEN cDNA 4933412E24 gene
Synonyms
MMRRC Submission 043024-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5462 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location60014866-60016613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60015068 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 508 (F508L)
Ref Sequence ENSEMBL: ENSMUSP00000094154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096421]
Predicted Effect probably benign
Transcript: ENSMUST00000096421
AA Change: F508L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094154
Gene: ENSMUSG00000071749
AA Change: F508L

DomainStartEndE-ValueType
Pfam:DUF4641 79 509 5.4e-189 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik G A 16: 4,864,363 G180E probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Amz1 A G 5: 140,748,221 Y184C probably damaging Het
Calm3 A T 7: 16,917,694 D23E possibly damaging Het
Cep112 T A 11: 108,518,744 N479K probably damaging Het
Csmd1 A C 8: 15,961,486 N2522K probably benign Het
D3Ertd254e C T 3: 36,165,820 T664I possibly damaging Het
Dhx30 A G 9: 110,100,974 L18P probably damaging Het
E2f2 A T 4: 136,172,913 T45S probably benign Het
Grk3 T C 5: 112,969,208 Y67C probably damaging Het
Htt T A 5: 34,885,507 C2290* probably null Het
Igsf10 T C 3: 59,325,754 T1853A probably damaging Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mast2 A G 4: 116,307,458 L1587P probably damaging Het
Mdn1 A G 4: 32,720,897 N2337D probably benign Het
Mettl3 T C 14: 52,299,879 Q182R probably damaging Het
Mterf1b A G 5: 4,196,541 S61G probably benign Het
Mycbp2 T C 14: 103,200,126 Y2100C probably damaging Het
Nt5m T A 11: 59,874,559 W138R probably damaging Het
Olfr998 A G 2: 85,591,296 Y252C probably damaging Het
Prex1 A G 2: 166,644,808 Y114H probably benign Het
Rasa2 A T 9: 96,571,918 S322T probably damaging Het
Sis A T 3: 72,949,838 D373E probably damaging Het
Snx29 A T 16: 11,511,012 M552L possibly damaging Het
Sptbn1 G T 11: 30,100,520 F2356L possibly damaging Het
Tbc1d10c G T 19: 4,188,053 Q241K probably benign Het
Vmn1r222 A G 13: 23,232,875 I56T probably benign Het
Vmn2r111 T C 17: 22,548,257 Y753C probably damaging Het
Vmn2r37 A G 7: 9,217,974 W297R probably damaging Het
Wdr66 T C 5: 123,298,632 probably null Het
Zfp651 G T 9: 121,767,663 R695L probably damaging Het
Other mutations in 4933412E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:4933412E24Rik APN 15 60015575 missense possibly damaging 0.82
IGL02078:4933412E24Rik APN 15 60016330 missense probably benign 0.02
IGL02493:4933412E24Rik APN 15 60016463 missense probably benign 0.00
IGL03336:4933412E24Rik APN 15 60016402 missense probably benign 0.00
R0466:4933412E24Rik UTSW 15 60015472 missense probably benign 0.00
R0961:4933412E24Rik UTSW 15 60015311 missense probably benign 0.36
R1765:4933412E24Rik UTSW 15 60015345 nonsense probably null
R2341:4933412E24Rik UTSW 15 60016363 missense possibly damaging 0.85
R2440:4933412E24Rik UTSW 15 60016280 missense probably benign
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R4039:4933412E24Rik UTSW 15 60016366 missense possibly damaging 0.95
R4416:4933412E24Rik UTSW 15 60016423 missense possibly damaging 0.88
R4868:4933412E24Rik UTSW 15 60015968 missense possibly damaging 0.50
R4907:4933412E24Rik UTSW 15 60016108 missense probably benign 0.00
R7275:4933412E24Rik UTSW 15 60015889 missense probably benign 0.32
R7842:4933412E24Rik UTSW 15 60016573 missense probably damaging 1.00
R8261:4933412E24Rik UTSW 15 60016576 missense probably benign 0.44
R8297:4933412E24Rik UTSW 15 60015675 missense probably damaging 1.00
X0052:4933412E24Rik UTSW 15 60016526 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCAGAAACAAGCCAGCGTTC -3'
(R):5'- CCAAGAAATCTGTACTCTCTGGTG -3'

Sequencing Primer
(F):5'- GAAACAAGCCAGCGTTCTTTAG -3'
(R):5'- TACCTGGAACACAAGGCT -3'
Posted On2016-10-06