Incidental Mutation 'R5463:Whrn'
ID433091
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Namewhirlin
SynonymsC430046P22Rik, Dfnb31, wi, 1110035G07Rik
MMRRC Submission 043025-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5463 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location63414910-63495991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63432816 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 427 (T427I)
Ref Sequence ENSEMBL: ENSMUSP00000103016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
Predicted Effect probably benign
Transcript: ENSMUST00000063650
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063672
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084510
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102867
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107393
AA Change: T427I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: T427I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145133
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,570,199 probably benign Het
Arhgap29 T A 3: 121,988,551 S71T possibly damaging Het
BC048507 T C 13: 67,863,698 Y65H probably damaging Het
C3 T C 17: 57,211,720 E1221G probably benign Het
Calb1 G T 4: 15,885,656 V76L probably benign Het
Crybg1 T A 10: 44,003,693 K500* probably null Het
Csmd1 G A 8: 15,984,860 T2437I probably benign Het
Cyp27b1 G A 10: 127,052,097 V493I possibly damaging Het
Cyp3a44 T A 5: 145,803,744 T29S probably benign Het
Dclk3 T C 9: 111,469,260 V624A probably benign Het
Dnah6 T C 6: 73,092,157 I2464V probably benign Het
Dock6 A T 9: 21,809,958 probably null Het
Erap1 C T 13: 74,646,414 T64I probably damaging Het
Erbb3 A T 10: 128,570,079 Y1156* probably null Het
Fam168a G A 7: 100,835,395 A231T probably benign Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxo30 T C 10: 11,291,069 Y512H probably damaging Het
Gcnt2 A T 13: 40,918,174 I98F possibly damaging Het
Got1 G A 19: 43,504,597 T295I probably benign Het
Herc2 A G 7: 56,194,262 E3538G probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Letmd1 C T 15: 100,469,128 A2V probably damaging Het
Lynx1 G T 15: 74,751,613 Y28* probably null Het
Mast1 T C 8: 84,925,507 E304G probably damaging Het
Nipa1 G A 7: 55,979,457 Q303* probably null Het
Nomo1 G A 7: 46,063,002 R657H possibly damaging Het
Olfr66 C T 7: 103,881,334 R303H probably benign Het
Pcdha7 T A 18: 36,975,575 L551Q probably damaging Het
Pik3r4 T C 9: 105,648,731 Y267H probably damaging Het
Pnliprp1 A G 19: 58,734,736 D223G probably damaging Het
Prph G A 15: 99,055,400 G65D probably benign Het
Pskh1 T C 8: 105,912,832 L48P probably benign Het
Ptdss1 C A 13: 66,945,301 N68K probably damaging Het
Rexo5 G A 7: 119,834,303 G495R probably damaging Het
Ryr1 C A 7: 29,024,023 A4204S possibly damaging Het
Serpinb9 G A 13: 33,015,676 S318N probably damaging Het
Slc22a8 G A 19: 8,609,274 R383H probably benign Het
Trim26 A G 17: 36,851,124 H145R probably damaging Het
Trps1 A T 15: 50,831,890 Y286* probably null Het
Vmn1r181 A G 7: 23,984,362 N84S probably benign Het
Wdfy4 G T 14: 33,151,732 Q207K probably benign Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63472778 missense probably damaging 1.00
IGL01643:Whrn APN 4 63416435 missense possibly damaging 0.79
IGL02065:Whrn APN 4 63418585 missense possibly damaging 0.52
IGL02119:Whrn APN 4 63435487 missense probably damaging 0.99
IGL02589:Whrn APN 4 63418097 nonsense probably null
IGL02638:Whrn APN 4 63419472 missense possibly damaging 0.47
IGL02865:Whrn APN 4 63415492 missense probably benign 0.08
IGL02934:Whrn APN 4 63416105 missense probably damaging 1.00
IGL03372:Whrn APN 4 63418618 missense probably damaging 0.96
R0090:Whrn UTSW 4 63432732 missense possibly damaging 0.79
R0592:Whrn UTSW 4 63415567 missense probably damaging 1.00
R0631:Whrn UTSW 4 63419489 missense probably damaging 1.00
R1916:Whrn UTSW 4 63494732 missense probably damaging 1.00
R1933:Whrn UTSW 4 63415639 nonsense probably null
R1958:Whrn UTSW 4 63435429 missense possibly damaging 0.62
R2255:Whrn UTSW 4 63418148 missense possibly damaging 0.92
R2513:Whrn UTSW 4 63435412 missense probably benign 0.22
R3699:Whrn UTSW 4 63461412 splice site probably benign
R3919:Whrn UTSW 4 63495184 nonsense probably null
R4016:Whrn UTSW 4 63415639 nonsense probably null
R4241:Whrn UTSW 4 63432973 unclassified probably benign
R4517:Whrn UTSW 4 63461280 critical splice donor site probably null
R4739:Whrn UTSW 4 63418165 missense probably damaging 1.00
R5207:Whrn UTSW 4 63432714 missense probably damaging 1.00
R5281:Whrn UTSW 4 63418427 missense probably benign 0.04
R5307:Whrn UTSW 4 63431843 missense probably benign 0.01
R5663:Whrn UTSW 4 63418448 missense probably damaging 0.98
R5754:Whrn UTSW 4 63416588 missense probably damaging 0.98
R5933:Whrn UTSW 4 63494708 missense probably damaging 1.00
R6212:Whrn UTSW 4 63494686 nonsense probably null
R6380:Whrn UTSW 4 63418592 missense possibly damaging 0.90
R6381:Whrn UTSW 4 63472684 missense probably benign 0.00
R7030:Whrn UTSW 4 63495131 unclassified probably benign
R7350:Whrn UTSW 4 63431959 missense possibly damaging 0.71
R7382:Whrn UTSW 4 63418336 missense probably benign
R7419:Whrn UTSW 4 63416093 missense possibly damaging 0.94
R8334:Whrn UTSW 4 63494810 missense probably damaging 1.00
X0009:Whrn UTSW 4 63431911 missense probably benign 0.00
Z1176:Whrn UTSW 4 63415566 missense probably damaging 1.00
Z1177:Whrn UTSW 4 63418499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGAGGTCCTTTGTAACAGG -3'
(R):5'- AAAGTGCCACGGAGATGACC -3'

Sequencing Primer
(F):5'- CCTTTGTAACAGGGTAGGGAC -3'
(R):5'- TGCCACGGAGATGACCACATG -3'
Posted On2016-10-06