Incidental Mutation 'R5463:Whrn'
ID 433091
Institutional Source Beutler Lab
Gene Symbol Whrn
Ensembl Gene ENSMUSG00000039137
Gene Name whirlin
Synonyms 1110035G07Rik, wi, Ush2d, Dfnb31, C430046P22Rik
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 63333147-63414228 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 63351053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 427 (T427I)
Ref Sequence ENSEMBL: ENSMUSP00000103016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063650] [ENSMUST00000063672] [ENSMUST00000084510] [ENSMUST00000095037] [ENSMUST00000095038] [ENSMUST00000102867] [ENSMUST00000107393] [ENSMUST00000119294]
AlphaFold Q80VW5
Predicted Effect probably benign
Transcript: ENSMUST00000063650
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069664
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 824 904 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063672
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065838
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084510
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081557
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 640 653 N/A INTRINSIC
PDZ 835 915 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095037
SMART Domains Protein: ENSMUSP00000092647
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
PDZ 321 401 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095038
SMART Domains Protein: ENSMUSP00000092648
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
PDZ 393 473 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102867
AA Change: T423I

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099931
Gene: ENSMUSG00000039137
AA Change: T423I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 3.62e-21 SMART
PDZ 289 361 3.77e-19 SMART
low complexity region 522 541 N/A INTRINSIC
low complexity region 629 642 N/A INTRINSIC
PDZ 823 903 2.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107393
AA Change: T427I

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103016
Gene: ENSMUSG00000039137
AA Change: T427I

DomainStartEndE-ValueType
low complexity region 3 38 N/A INTRINSIC
low complexity region 126 137 N/A INTRINSIC
PDZ 151 223 1.7e-23 SMART
PDZ 289 361 1.8e-21 SMART
low complexity region 526 545 N/A INTRINSIC
low complexity region 633 646 N/A INTRINSIC
PDZ 828 908 1.3e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119294
SMART Domains Protein: ENSMUSP00000114030
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
low complexity region 80 99 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
PDZ 382 462 2.63e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148957
Predicted Effect probably benign
Transcript: ENSMUST00000144965
SMART Domains Protein: ENSMUSP00000121944
Gene: ENSMUSG00000039137

DomainStartEndE-ValueType
PDB:1UF1|A 16 74 7e-33 PDB
SCOP:d1lcya1 32 74 1e-7 SMART
Blast:PDZ 40 74 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145630
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein required for elongation and actin polymerization in the hair cell stereocilia. The encoded protein is localized to the cytoplasm and co-localizes with the growing end of actin filaments. Mutations in this gene have been linked to deafness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Spontaneous mutants lacking both isoforms show short stereocilia, severe deafness and vestibular deficits. Targeted homozygotes lacking the long form show altered OHC stereocilia bundles but a milder phenotype with normal stereocilia in IHCs and a subset of vestibular HCs and no vestibular deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Other mutations in Whrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01588:Whrn APN 4 63,391,015 (GRCm39) missense probably damaging 1.00
IGL01643:Whrn APN 4 63,334,672 (GRCm39) missense possibly damaging 0.79
IGL02065:Whrn APN 4 63,336,822 (GRCm39) missense possibly damaging 0.52
IGL02119:Whrn APN 4 63,353,724 (GRCm39) missense probably damaging 0.99
IGL02589:Whrn APN 4 63,336,334 (GRCm39) nonsense probably null
IGL02638:Whrn APN 4 63,337,709 (GRCm39) missense possibly damaging 0.47
IGL02865:Whrn APN 4 63,333,729 (GRCm39) missense probably benign 0.08
IGL02934:Whrn APN 4 63,334,342 (GRCm39) missense probably damaging 1.00
IGL03372:Whrn APN 4 63,336,855 (GRCm39) missense probably damaging 0.96
R0090:Whrn UTSW 4 63,350,969 (GRCm39) missense possibly damaging 0.79
R0592:Whrn UTSW 4 63,333,804 (GRCm39) missense probably damaging 1.00
R0631:Whrn UTSW 4 63,337,726 (GRCm39) missense probably damaging 1.00
R1916:Whrn UTSW 4 63,412,969 (GRCm39) missense probably damaging 1.00
R1933:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R1958:Whrn UTSW 4 63,353,666 (GRCm39) missense possibly damaging 0.62
R2255:Whrn UTSW 4 63,336,385 (GRCm39) missense possibly damaging 0.92
R2513:Whrn UTSW 4 63,353,649 (GRCm39) missense probably benign 0.22
R3699:Whrn UTSW 4 63,379,649 (GRCm39) splice site probably benign
R3919:Whrn UTSW 4 63,413,421 (GRCm39) nonsense probably null
R4016:Whrn UTSW 4 63,333,876 (GRCm39) nonsense probably null
R4241:Whrn UTSW 4 63,351,210 (GRCm39) unclassified probably benign
R4517:Whrn UTSW 4 63,379,517 (GRCm39) critical splice donor site probably null
R4739:Whrn UTSW 4 63,336,402 (GRCm39) missense probably damaging 1.00
R5207:Whrn UTSW 4 63,350,951 (GRCm39) missense probably damaging 1.00
R5281:Whrn UTSW 4 63,336,664 (GRCm39) missense probably benign 0.04
R5307:Whrn UTSW 4 63,350,080 (GRCm39) missense probably benign 0.01
R5663:Whrn UTSW 4 63,336,685 (GRCm39) missense probably damaging 0.98
R5754:Whrn UTSW 4 63,334,825 (GRCm39) missense probably damaging 0.98
R5933:Whrn UTSW 4 63,412,945 (GRCm39) missense probably damaging 1.00
R6212:Whrn UTSW 4 63,412,923 (GRCm39) nonsense probably null
R6380:Whrn UTSW 4 63,336,829 (GRCm39) missense possibly damaging 0.90
R6381:Whrn UTSW 4 63,390,921 (GRCm39) missense probably benign 0.00
R7030:Whrn UTSW 4 63,413,368 (GRCm39) unclassified probably benign
R7350:Whrn UTSW 4 63,350,196 (GRCm39) missense possibly damaging 0.71
R7382:Whrn UTSW 4 63,336,573 (GRCm39) missense probably benign
R7419:Whrn UTSW 4 63,334,330 (GRCm39) missense possibly damaging 0.94
R8334:Whrn UTSW 4 63,413,047 (GRCm39) missense probably damaging 1.00
R9378:Whrn UTSW 4 63,350,079 (GRCm39) missense probably benign 0.00
X0009:Whrn UTSW 4 63,350,148 (GRCm39) missense probably benign 0.00
Z1176:Whrn UTSW 4 63,333,803 (GRCm39) missense probably damaging 1.00
Z1177:Whrn UTSW 4 63,336,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGAGGTCCTTTGTAACAGG -3'
(R):5'- AAAGTGCCACGGAGATGACC -3'

Sequencing Primer
(F):5'- CCTTTGTAACAGGGTAGGGAC -3'
(R):5'- TGCCACGGAGATGACCACATG -3'
Posted On 2016-10-06