Incidental Mutation 'R5463:Cyp3a44'
ID 433092
Institutional Source Beutler Lab
Gene Symbol Cyp3a44
Ensembl Gene ENSMUSG00000054417
Gene Name cytochrome P450, family 3, subfamily a, polypeptide 44
Synonyms
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 145710793-145742684 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 145740554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 29 (T29S)
Ref Sequence ENSEMBL: ENSMUSP00000069932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067479]
AlphaFold Q9EQW4
Predicted Effect probably benign
Transcript: ENSMUST00000067479
AA Change: T29S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000069932
Gene: ENSMUSG00000054417
AA Change: T29S

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:p450 38 494 2.4e-133 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Cyp3a44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Cyp3a44 APN 5 145,711,157 (GRCm39) makesense probably null
IGL00972:Cyp3a44 APN 5 145,716,534 (GRCm39) missense possibly damaging 0.84
IGL01062:Cyp3a44 APN 5 145,731,149 (GRCm39) missense possibly damaging 0.88
IGL01072:Cyp3a44 APN 5 145,728,438 (GRCm39) missense probably benign 0.01
IGL01515:Cyp3a44 APN 5 145,736,228 (GRCm39) nonsense probably null
IGL01738:Cyp3a44 APN 5 145,731,745 (GRCm39) missense probably damaging 1.00
IGL01869:Cyp3a44 APN 5 145,727,496 (GRCm39) missense probably damaging 0.99
IGL02269:Cyp3a44 APN 5 145,742,547 (GRCm39) missense probably benign 0.23
IGL02284:Cyp3a44 APN 5 145,725,179 (GRCm39) missense possibly damaging 0.91
IGL02479:Cyp3a44 APN 5 145,727,477 (GRCm39) missense probably benign 0.01
IGL02480:Cyp3a44 APN 5 145,731,715 (GRCm39) missense possibly damaging 0.93
IGL02506:Cyp3a44 APN 5 145,736,198 (GRCm39) missense probably damaging 1.00
IGL02957:Cyp3a44 APN 5 145,716,472 (GRCm39) nonsense probably null
IGL02978:Cyp3a44 APN 5 145,725,208 (GRCm39) missense probably damaging 0.98
R0427:Cyp3a44 UTSW 5 145,716,412 (GRCm39) missense possibly damaging 0.85
R1240:Cyp3a44 UTSW 5 145,711,250 (GRCm39) missense probably benign 0.02
R1247:Cyp3a44 UTSW 5 145,728,477 (GRCm39) missense probably damaging 1.00
R1657:Cyp3a44 UTSW 5 145,716,553 (GRCm39) missense probably damaging 0.99
R2096:Cyp3a44 UTSW 5 145,725,215 (GRCm39) missense probably damaging 1.00
R2156:Cyp3a44 UTSW 5 145,740,480 (GRCm39) nonsense probably null
R2412:Cyp3a44 UTSW 5 145,716,389 (GRCm39) nonsense probably null
R4817:Cyp3a44 UTSW 5 145,740,565 (GRCm39) missense possibly damaging 0.64
R4884:Cyp3a44 UTSW 5 145,714,792 (GRCm39) missense probably damaging 1.00
R5266:Cyp3a44 UTSW 5 145,731,207 (GRCm39) missense possibly damaging 0.66
R5301:Cyp3a44 UTSW 5 145,725,326 (GRCm39) missense probably damaging 0.99
R5625:Cyp3a44 UTSW 5 145,716,376 (GRCm39) missense possibly damaging 0.74
R5635:Cyp3a44 UTSW 5 145,738,124 (GRCm39) missense possibly damaging 0.90
R5924:Cyp3a44 UTSW 5 145,731,137 (GRCm39) missense possibly damaging 0.54
R5964:Cyp3a44 UTSW 5 145,725,277 (GRCm39) missense possibly damaging 0.95
R5988:Cyp3a44 UTSW 5 145,731,728 (GRCm39) missense probably damaging 1.00
R6011:Cyp3a44 UTSW 5 145,738,084 (GRCm39) critical splice donor site probably null
R6032:Cyp3a44 UTSW 5 145,714,756 (GRCm39) missense probably damaging 1.00
R6032:Cyp3a44 UTSW 5 145,714,756 (GRCm39) missense probably damaging 1.00
R6413:Cyp3a44 UTSW 5 145,731,254 (GRCm39) missense probably damaging 1.00
R6579:Cyp3a44 UTSW 5 145,727,516 (GRCm39) missense probably damaging 0.99
R6587:Cyp3a44 UTSW 5 145,742,569 (GRCm39) missense probably benign 0.23
R6709:Cyp3a44 UTSW 5 145,714,902 (GRCm39) splice site probably null
R6727:Cyp3a44 UTSW 5 145,731,781 (GRCm39) nonsense probably null
R6825:Cyp3a44 UTSW 5 145,716,396 (GRCm39) missense probably damaging 1.00
R7142:Cyp3a44 UTSW 5 145,714,771 (GRCm39) missense probably benign 0.24
R7352:Cyp3a44 UTSW 5 145,740,498 (GRCm39) missense probably benign 0.01
R7921:Cyp3a44 UTSW 5 145,728,498 (GRCm39) missense probably damaging 1.00
R7962:Cyp3a44 UTSW 5 145,738,135 (GRCm39) missense probably benign
R8099:Cyp3a44 UTSW 5 145,725,212 (GRCm39) missense probably benign 0.12
R8240:Cyp3a44 UTSW 5 145,725,257 (GRCm39) missense probably damaging 0.99
R8836:Cyp3a44 UTSW 5 145,731,728 (GRCm39) missense probably damaging 1.00
R8923:Cyp3a44 UTSW 5 145,736,171 (GRCm39) missense probably damaging 1.00
R8934:Cyp3a44 UTSW 5 145,731,786 (GRCm39) missense possibly damaging 0.70
R9019:Cyp3a44 UTSW 5 145,727,519 (GRCm39) missense probably damaging 1.00
R9287:Cyp3a44 UTSW 5 145,725,202 (GRCm39) missense possibly damaging 0.93
R9293:Cyp3a44 UTSW 5 145,711,187 (GRCm39) missense probably benign 0.00
R9425:Cyp3a44 UTSW 5 145,740,548 (GRCm39) nonsense probably null
Z1176:Cyp3a44 UTSW 5 145,728,474 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGGACCCGATATCTCAGG -3'
(R):5'- ATCCCTAGATCCATGAGAACTCAGC -3'

Sequencing Primer
(F):5'- GAGGACCCGATATCTCAGGATTTC -3'
(R):5'- GCATACATGAATACCAGCAGTTG -3'
Posted On 2016-10-06