Incidental Mutation 'R5463:Or51b4'
ID 433100
Institutional Source Beutler Lab
Gene Symbol Or51b4
Ensembl Gene ENSMUSG00000058200
Gene Name olfactory receptor family 51 subfamily B member 4
Synonyms GA_x6K02T2PBJ9-6620959-6620024, 5'[b]1, Olfr66, MOR1-3
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103530513-103531448 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103530541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 303 (R303H)
Ref Sequence ENSEMBL: ENSMUSP00000149058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079117] [ENSMUST00000216303]
AlphaFold F8VQ01
Predicted Effect probably benign
Transcript: ENSMUST00000079117
AA Change: R303H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078119
Gene: ENSMUSG00000058200
AA Change: R303H

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 3.9e-113 PFAM
Pfam:7TM_GPCR_Srsx 32 300 9.7e-7 PFAM
Pfam:7tm_1 39 290 8.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120890
Predicted Effect probably benign
Transcript: ENSMUST00000216303
AA Change: R303H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Rexo5 G A 7: 119,433,526 (GRCm39) G495R probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Or51b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02342:Or51b4 APN 7 103,530,587 (GRCm39) missense probably benign 0.16
IGL02935:Or51b4 APN 7 103,530,871 (GRCm39) missense probably damaging 1.00
IGL03033:Or51b4 APN 7 103,530,724 (GRCm39) missense probably damaging 1.00
IGL03105:Or51b4 APN 7 103,531,339 (GRCm39) missense possibly damaging 0.55
R1081:Or51b4 UTSW 7 103,531,384 (GRCm39) missense possibly damaging 0.87
R1780:Or51b4 UTSW 7 103,530,799 (GRCm39) missense probably benign 0.00
R4470:Or51b4 UTSW 7 103,530,956 (GRCm39) missense probably benign 0.02
R4724:Or51b4 UTSW 7 103,530,856 (GRCm39) missense probably benign 0.02
R5498:Or51b4 UTSW 7 103,530,839 (GRCm39) missense probably damaging 0.97
R5987:Or51b4 UTSW 7 103,530,907 (GRCm39) missense probably damaging 0.99
R6054:Or51b4 UTSW 7 103,531,033 (GRCm39) missense probably damaging 0.98
R7815:Or51b4 UTSW 7 103,530,992 (GRCm39) missense probably benign 0.16
R8026:Or51b4 UTSW 7 103,530,904 (GRCm39) missense possibly damaging 0.96
R9114:Or51b4 UTSW 7 103,530,569 (GRCm39) missense possibly damaging 0.96
R9570:Or51b4 UTSW 7 103,530,856 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTGTGCCTTAGCCAAACTATTTC -3'
(R):5'- ACATTAGCTGTGTCCTGGTC -3'

Sequencing Primer
(F):5'- TACAGAACCAGAACTATTCCATCTG -3'
(R):5'- GGTCTTTTACATCACTGTGATTGGCC -3'
Posted On 2016-10-06