Incidental Mutation 'R5463:Rexo5'
ID 433101
Institutional Source Beutler Lab
Gene Symbol Rexo5
Ensembl Gene ENSMUSG00000030924
Gene Name RNA exonuclease 5
Synonyms 2610020H08Rik
MMRRC Submission 043025-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R5463 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 119393229-119448166 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119433526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 495 (G495R)
Ref Sequence ENSEMBL: ENSMUSP00000102130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033218] [ENSMUST00000084644] [ENSMUST00000106520] [ENSMUST00000133758]
AlphaFold D3YW29
Predicted Effect probably damaging
Transcript: ENSMUST00000033218
AA Change: G428R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033218
Gene: ENSMUSG00000030924
AA Change: G428R

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
Pfam:RNase_T 225 330 1.4e-12 PFAM
Blast:RRM 424 463 5e-17 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000084644
AA Change: G302R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081694
Gene: ENSMUSG00000030924
AA Change: G302R

DomainStartEndE-ValueType
EXOIII 31 189 2.72e-29 SMART
RRM 298 367 3.23e-9 SMART
Blast:RRM 393 437 2e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106520
AA Change: G495R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102130
Gene: ENSMUSG00000030924
AA Change: G495R

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
EXOIII 223 381 2.72e-29 SMART
RRM 491 560 3.23e-9 SMART
RRM 586 661 3.28e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149132
Predicted Effect probably benign
Transcript: ENSMUST00000207042
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,406,104 (GRCm39) probably benign Het
Arhgap29 T A 3: 121,782,200 (GRCm39) S71T possibly damaging Het
BC048507 T C 13: 68,011,817 (GRCm39) Y65H probably damaging Het
C3 T C 17: 57,518,720 (GRCm39) E1221G probably benign Het
Calb1 G T 4: 15,885,656 (GRCm39) V76L probably benign Het
Crybg1 T A 10: 43,879,689 (GRCm39) K500* probably null Het
Csmd1 G A 8: 16,034,860 (GRCm39) T2437I probably benign Het
Cyp27b1 G A 10: 126,887,966 (GRCm39) V493I possibly damaging Het
Cyp3a44 T A 5: 145,740,554 (GRCm39) T29S probably benign Het
Dclk3 T C 9: 111,298,328 (GRCm39) V624A probably benign Het
Dnah6 T C 6: 73,069,140 (GRCm39) I2464V probably benign Het
Dock6 A T 9: 21,721,254 (GRCm39) probably null Het
Erap1 C T 13: 74,794,533 (GRCm39) T64I probably damaging Het
Erbb3 A T 10: 128,405,948 (GRCm39) Y1156* probably null Het
Fam168a G A 7: 100,484,602 (GRCm39) A231T probably benign Het
Farp1 C T 14: 121,472,489 (GRCm39) P208L probably damaging Het
Fbxo30 T C 10: 11,166,813 (GRCm39) Y512H probably damaging Het
Gcnt2 A T 13: 41,071,650 (GRCm39) I98F possibly damaging Het
Got1 G A 19: 43,493,036 (GRCm39) T295I probably benign Het
Herc2 A G 7: 55,844,010 (GRCm39) E3538G probably damaging Het
Kcnmb4 A T 10: 116,309,410 (GRCm39) V6E probably benign Het
Kmt2d G A 15: 98,749,990 (GRCm39) probably benign Het
Letmd1 C T 15: 100,367,009 (GRCm39) A2V probably damaging Het
Lynx1 G T 15: 74,623,462 (GRCm39) Y28* probably null Het
Mast1 T C 8: 85,652,136 (GRCm39) E304G probably damaging Het
Nipa1 G A 7: 55,629,205 (GRCm39) Q303* probably null Het
Nomo1 G A 7: 45,712,426 (GRCm39) R657H possibly damaging Het
Or51b4 C T 7: 103,530,541 (GRCm39) R303H probably benign Het
Pcdha7 T A 18: 37,108,628 (GRCm39) L551Q probably damaging Het
Pik3r4 T C 9: 105,525,930 (GRCm39) Y267H probably damaging Het
Pnliprp1 A G 19: 58,723,168 (GRCm39) D223G probably damaging Het
Prph G A 15: 98,953,281 (GRCm39) G65D probably benign Het
Pskh1 T C 8: 106,639,464 (GRCm39) L48P probably benign Het
Ptdss1 C A 13: 67,093,365 (GRCm39) N68K probably damaging Het
Ryr1 C A 7: 28,723,448 (GRCm39) A4204S possibly damaging Het
Serpinb9 G A 13: 33,199,659 (GRCm39) S318N probably damaging Het
Slc22a8 G A 19: 8,586,638 (GRCm39) R383H probably benign Het
Trim26 A G 17: 37,162,016 (GRCm39) H145R probably damaging Het
Trps1 A T 15: 50,695,286 (GRCm39) Y286* probably null Het
Vmn1r181 A G 7: 23,683,787 (GRCm39) N84S probably benign Het
Wdfy4 G T 14: 32,873,689 (GRCm39) Q207K probably benign Het
Whrn G A 4: 63,351,053 (GRCm39) T427I probably benign Het
Other mutations in Rexo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rexo5 APN 7 119,433,499 (GRCm39) missense probably damaging 1.00
R0347:Rexo5 UTSW 7 119,423,119 (GRCm39) critical splice donor site probably null
R0442:Rexo5 UTSW 7 119,442,508 (GRCm39) missense probably damaging 1.00
R0589:Rexo5 UTSW 7 119,444,606 (GRCm39) missense probably benign 0.00
R0980:Rexo5 UTSW 7 119,423,035 (GRCm39) missense probably damaging 1.00
R1465:Rexo5 UTSW 7 119,400,581 (GRCm39) critical splice donor site probably null
R1465:Rexo5 UTSW 7 119,400,581 (GRCm39) critical splice donor site probably null
R1505:Rexo5 UTSW 7 119,398,826 (GRCm39) nonsense probably null
R1775:Rexo5 UTSW 7 119,444,634 (GRCm39) missense probably benign 0.00
R1911:Rexo5 UTSW 7 119,398,867 (GRCm39) missense probably damaging 1.00
R1996:Rexo5 UTSW 7 119,423,080 (GRCm39) missense probably damaging 1.00
R4168:Rexo5 UTSW 7 119,426,621 (GRCm39) intron probably benign
R4169:Rexo5 UTSW 7 119,426,621 (GRCm39) intron probably benign
R4402:Rexo5 UTSW 7 119,433,599 (GRCm39) missense possibly damaging 0.82
R4486:Rexo5 UTSW 7 119,424,800 (GRCm39) missense probably benign 0.00
R4620:Rexo5 UTSW 7 119,426,526 (GRCm39) missense probably benign 0.37
R4621:Rexo5 UTSW 7 119,418,722 (GRCm39) missense probably benign 0.19
R4865:Rexo5 UTSW 7 119,400,553 (GRCm39) nonsense probably null
R4884:Rexo5 UTSW 7 119,424,774 (GRCm39) nonsense probably null
R5171:Rexo5 UTSW 7 119,423,002 (GRCm39) missense probably damaging 1.00
R5209:Rexo5 UTSW 7 119,433,522 (GRCm39) nonsense probably null
R5266:Rexo5 UTSW 7 119,443,660 (GRCm39) missense probably benign 0.00
R5579:Rexo5 UTSW 7 119,433,626 (GRCm39) critical splice donor site probably null
R6163:Rexo5 UTSW 7 119,404,470 (GRCm39) missense probably damaging 1.00
R6305:Rexo5 UTSW 7 119,427,348 (GRCm39) missense probably damaging 1.00
R7144:Rexo5 UTSW 7 119,404,414 (GRCm39) missense probably damaging 1.00
R7282:Rexo5 UTSW 7 119,417,636 (GRCm39) missense probably damaging 0.97
R8143:Rexo5 UTSW 7 119,433,484 (GRCm39) splice site probably null
R8379:Rexo5 UTSW 7 119,433,508 (GRCm39) missense probably benign 0.03
R8550:Rexo5 UTSW 7 119,400,568 (GRCm39) missense probably benign 0.01
R8841:Rexo5 UTSW 7 119,448,011 (GRCm39) missense probably benign 0.00
R9133:Rexo5 UTSW 7 119,444,667 (GRCm39) missense probably damaging 1.00
R9287:Rexo5 UTSW 7 119,402,025 (GRCm39) missense probably damaging 1.00
R9404:Rexo5 UTSW 7 119,400,542 (GRCm39) missense probably damaging 1.00
R9499:Rexo5 UTSW 7 119,404,480 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCACCATGTGAGTGCTGG -3'
(R):5'- TCACTGTACTATTAGCTGCACAG -3'

Sequencing Primer
(F):5'- GGTACCAAACCTAGATCTTCTGC -3'
(R):5'- TGCACAGCCCCCACAAC -3'
Posted On 2016-10-06