Mutagenetix > Incidental Mutation

Incidental Mutation 'R5463:Mast1'

433103

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

MMRRC Submission

043025-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5463 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84925507 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 304 (E304G)

Ref Sequence

ENSEMBL: ENSMUSP00000105363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000109741
AA Change: E304G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: E304G

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119820
AA Change: E304G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: E304G

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175085

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A930009A15Rik	A	C	10: 115,570,199		probably benign	Het
Arhgap29	T	A	3: 121,988,551	S71T	possibly damaging	Het
BC048507	T	C	13: 67,863,698	Y65H	probably damaging	Het
C3	T	C	17: 57,211,720	E1221G	probably benign	Het
Calb1	G	T	4: 15,885,656	V76L	probably benign	Het
Crybg1	T	A	10: 44,003,693	K500*	probably null	Het
Csmd1	G	A	8: 15,984,860	T2437I	probably benign	Het
Cyp27b1	G	A	10: 127,052,097	V493I	possibly damaging	Het
Cyp3a44	T	A	5: 145,803,744	T29S	probably benign	Het
Dclk3	T	C	9: 111,469,260	V624A	probably benign	Het
Dnah6	T	C	6: 73,092,157	I2464V	probably benign	Het
Dock6	A	T	9: 21,809,958		probably null	Het
Erap1	C	T	13: 74,646,414	T64I	probably damaging	Het
Erbb3	A	T	10: 128,570,079	Y1156*	probably null	Het
Fam168a	G	A	7: 100,835,395	A231T	probably benign	Het
Farp1	C	T	14: 121,235,077	P208L	probably damaging	Het
Fbxo30	T	C	10: 11,291,069	Y512H	probably damaging	Het
Gcnt2	A	T	13: 40,918,174	I98F	possibly damaging	Het
Got1	G	A	19: 43,504,597	T295I	probably benign	Het
Herc2	A	G	7: 56,194,262	E3538G	probably damaging	Het
Kcnmb4	A	T	10: 116,473,505	V6E	probably benign	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Letmd1	C	T	15: 100,469,128	A2V	probably damaging	Het
Lynx1	G	T	15: 74,751,613	Y28*	probably null	Het
Nipa1	G	A	7: 55,979,457	Q303*	probably null	Het
Nomo1	G	A	7: 46,063,002	R657H	possibly damaging	Het
Olfr66	C	T	7: 103,881,334	R303H	probably benign	Het
Pcdha7	T	A	18: 36,975,575	L551Q	probably damaging	Het
Pik3r4	T	C	9: 105,648,731	Y267H	probably damaging	Het
Pnliprp1	A	G	19: 58,734,736	D223G	probably damaging	Het
Prph	G	A	15: 99,055,400	G65D	probably benign	Het
Pskh1	T	C	8: 105,912,832	L48P	probably benign	Het
Ptdss1	C	A	13: 66,945,301	N68K	probably damaging	Het
Rexo5	G	A	7: 119,834,303	G495R	probably damaging	Het
Ryr1	C	A	7: 29,024,023	A4204S	possibly damaging	Het
Serpinb9	G	A	13: 33,015,676	S318N	probably damaging	Het
Slc22a8	G	A	19: 8,609,274	R383H	probably benign	Het
Trim26	A	G	17: 36,851,124	H145R	probably damaging	Het
Trps1	A	T	15: 50,831,890	Y286*	probably null	Het
Vmn1r181	A	G	7: 23,984,362	N84S	probably benign	Het
Wdfy4	G	T	14: 33,151,732	Q207K	probably benign	Het
Whrn	G	A	4: 63,432,816	T427I	probably benign	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	splice site	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	84921415	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2318:Mast1	UTSW	8	84921125	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	84921361	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	84929246	missense	probably benign	0.02
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5546:Mast1	UTSW	8	84916260	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	84917754	missense	probably benign
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7164:Mast1	UTSW	8	84935304	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R8167:Mast1	UTSW	8	84921358	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	84912821	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	84916324	missense	probably damaging	1.00
R9477:Mast1	UTSW	8	84912150	missense	probably benign	0.18
R9526:Mast1	UTSW	8	84921176	missense	probably damaging	1.00
R9557:Mast1	UTSW	8	84930845	missense	probably damaging	1.00
R9655:Mast1	UTSW	8	84924031	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TCAGATGTGTCGTCTTGCTC -3'
(R):5'- TAATCATCTCTCGCCCTGCAAG -3'

Sequencing Primer
(F):5'- TCCGGAGTGTTGGAGCC -3'
(R):5'- CCTGCAAGGCTTCTGGAGTG -3'

Posted On

2016-10-06