Incidental Mutation 'R5463:Pik3r4'
ID433107
Institutional Source Beutler Lab
Gene Symbol Pik3r4
Ensembl Gene ENSMUSG00000032571
Gene Namephosphoinositide-3-kinase regulatory subunit 4
SynonymsD9Ertd418e, 2210010O15Rik, C730038E05Rik
MMRRC Submission 043025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5463 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location105642978-105687657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105648731 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 267 (Y267H)
Ref Sequence ENSEMBL: ENSMUSP00000140988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000188784] [ENSMUST00000190358] [ENSMUST00000191268]
Predicted Effect probably damaging
Transcript: ENSMUST00000065778
AA Change: Y267H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571
AA Change: Y267H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187573
Predicted Effect probably damaging
Transcript: ENSMUST00000188784
AA Change: Y267H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140988
Gene: ENSMUSG00000032571
AA Change: Y267H

DomainStartEndE-ValueType
S_TKc 26 301 2.8e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190358
SMART Domains Protein: ENSMUSP00000139643
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
S_TKc 26 174 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191117
Predicted Effect probably damaging
Transcript: ENSMUST00000191268
AA Change: Y267H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571
AA Change: Y267H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit earl embryonic lethality before E7.5. Mice homozygous for a conditional allele activated in muscles exhibit symptoms of autophagic vacuolar myopathies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930009A15Rik A C 10: 115,570,199 probably benign Het
Arhgap29 T A 3: 121,988,551 S71T possibly damaging Het
BC048507 T C 13: 67,863,698 Y65H probably damaging Het
C3 T C 17: 57,211,720 E1221G probably benign Het
Calb1 G T 4: 15,885,656 V76L probably benign Het
Crybg1 T A 10: 44,003,693 K500* probably null Het
Csmd1 G A 8: 15,984,860 T2437I probably benign Het
Cyp27b1 G A 10: 127,052,097 V493I possibly damaging Het
Cyp3a44 T A 5: 145,803,744 T29S probably benign Het
Dclk3 T C 9: 111,469,260 V624A probably benign Het
Dnah6 T C 6: 73,092,157 I2464V probably benign Het
Dock6 A T 9: 21,809,958 probably null Het
Erap1 C T 13: 74,646,414 T64I probably damaging Het
Erbb3 A T 10: 128,570,079 Y1156* probably null Het
Fam168a G A 7: 100,835,395 A231T probably benign Het
Farp1 C T 14: 121,235,077 P208L probably damaging Het
Fbxo30 T C 10: 11,291,069 Y512H probably damaging Het
Gcnt2 A T 13: 40,918,174 I98F possibly damaging Het
Got1 G A 19: 43,504,597 T295I probably benign Het
Herc2 A G 7: 56,194,262 E3538G probably damaging Het
Kcnmb4 A T 10: 116,473,505 V6E probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Letmd1 C T 15: 100,469,128 A2V probably damaging Het
Lynx1 G T 15: 74,751,613 Y28* probably null Het
Mast1 T C 8: 84,925,507 E304G probably damaging Het
Nipa1 G A 7: 55,979,457 Q303* probably null Het
Nomo1 G A 7: 46,063,002 R657H possibly damaging Het
Olfr66 C T 7: 103,881,334 R303H probably benign Het
Pcdha7 T A 18: 36,975,575 L551Q probably damaging Het
Pnliprp1 A G 19: 58,734,736 D223G probably damaging Het
Prph G A 15: 99,055,400 G65D probably benign Het
Pskh1 T C 8: 105,912,832 L48P probably benign Het
Ptdss1 C A 13: 66,945,301 N68K probably damaging Het
Rexo5 G A 7: 119,834,303 G495R probably damaging Het
Ryr1 C A 7: 29,024,023 A4204S possibly damaging Het
Serpinb9 G A 13: 33,015,676 S318N probably damaging Het
Slc22a8 G A 19: 8,609,274 R383H probably benign Het
Trim26 A G 17: 36,851,124 H145R probably damaging Het
Trps1 A T 15: 50,831,890 Y286* probably null Het
Vmn1r181 A G 7: 23,984,362 N84S probably benign Het
Wdfy4 G T 14: 33,151,732 Q207K probably benign Het
Whrn G A 4: 63,432,816 T427I probably benign Het
Other mutations in Pik3r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Pik3r4 APN 9 105644604 missense possibly damaging 0.75
IGL01617:Pik3r4 APN 9 105654965 missense probably benign 0.33
IGL01764:Pik3r4 APN 9 105685122 splice site probably benign
IGL01817:Pik3r4 APN 9 105650822 missense probably damaging 1.00
IGL01830:Pik3r4 APN 9 105644955 missense probably damaging 1.00
IGL01905:Pik3r4 APN 9 105644878 nonsense probably null
IGL01947:Pik3r4 APN 9 105686150 missense possibly damaging 0.91
IGL01985:Pik3r4 APN 9 105663045 missense probably benign 0.03
IGL02321:Pik3r4 APN 9 105644478 missense probably benign 0.04
IGL02389:Pik3r4 APN 9 105650331 missense possibly damaging 0.88
IGL02898:Pik3r4 APN 9 105650406 missense probably benign 0.21
IGL03037:Pik3r4 APN 9 105650813 missense probably damaging 1.00
boteh UTSW 9 105667938 splice site probably null
IGL02835:Pik3r4 UTSW 9 105672706 missense probably benign 0.07
R0011:Pik3r4 UTSW 9 105644637 missense probably benign 0.01
R0312:Pik3r4 UTSW 9 105686210 missense probably damaging 1.00
R0321:Pik3r4 UTSW 9 105648707 missense probably damaging 1.00
R0482:Pik3r4 UTSW 9 105669045 missense probably benign 0.04
R0645:Pik3r4 UTSW 9 105669187 splice site probably benign
R0690:Pik3r4 UTSW 9 105653976 missense possibly damaging 0.81
R0789:Pik3r4 UTSW 9 105685167 missense probably benign 0.14
R0894:Pik3r4 UTSW 9 105667771 missense possibly damaging 0.73
R0988:Pik3r4 UTSW 9 105687205 missense probably damaging 0.97
R1123:Pik3r4 UTSW 9 105663129 missense probably benign
R1172:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1174:Pik3r4 UTSW 9 105663174 missense probably damaging 1.00
R1342:Pik3r4 UTSW 9 105650901 critical splice donor site probably null
R1387:Pik3r4 UTSW 9 105644291 missense probably damaging 1.00
R1480:Pik3r4 UTSW 9 105687244 missense probably benign 0.39
R1638:Pik3r4 UTSW 9 105687209 missense probably damaging 1.00
R1643:Pik3r4 UTSW 9 105687152 missense possibly damaging 0.83
R1995:Pik3r4 UTSW 9 105669165 missense probably benign 0.12
R2037:Pik3r4 UTSW 9 105650335 missense probably benign 0.00
R2165:Pik3r4 UTSW 9 105672785 missense probably benign 0.05
R4210:Pik3r4 UTSW 9 105650758 missense possibly damaging 0.57
R4515:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4519:Pik3r4 UTSW 9 105672725 missense probably damaging 1.00
R4630:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4632:Pik3r4 UTSW 9 105654899 missense probably benign 0.06
R4732:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4733:Pik3r4 UTSW 9 105678176 missense possibly damaging 0.56
R4940:Pik3r4 UTSW 9 105668994 missense probably benign 0.20
R5120:Pik3r4 UTSW 9 105669009 missense probably benign 0.30
R5169:Pik3r4 UTSW 9 105678161 missense probably benign 0.14
R5183:Pik3r4 UTSW 9 105682308 missense possibly damaging 0.87
R5353:Pik3r4 UTSW 9 105667938 splice site probably null
R5635:Pik3r4 UTSW 9 105667825 missense probably benign 0.01
R5763:Pik3r4 UTSW 9 105669775 missense probably benign 0.01
R5830:Pik3r4 UTSW 9 105644824 nonsense probably null
R6251:Pik3r4 UTSW 9 105654048 missense probably benign
R6468:Pik3r4 UTSW 9 105685190 missense possibly damaging 0.86
R6611:Pik3r4 UTSW 9 105644277 missense probably damaging 0.99
R6642:Pik3r4 UTSW 9 105644646 missense probably benign 0.11
R6821:Pik3r4 UTSW 9 105650606 missense probably damaging 0.98
R7039:Pik3r4 UTSW 9 105676890 missense possibly damaging 0.76
R7144:Pik3r4 UTSW 9 105650584 missense probably damaging 0.98
R7410:Pik3r4 UTSW 9 105650591 missense probably damaging 0.99
R7559:Pik3r4 UTSW 9 105678153 missense probably benign 0.17
R7561:Pik3r4 UTSW 9 105687247 missense possibly damaging 0.94
R7658:Pik3r4 UTSW 9 105644511 missense probably damaging 0.98
R7727:Pik3r4 UTSW 9 105669882 missense probably damaging 0.99
R7871:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
R7954:Pik3r4 UTSW 9 105663117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTAGACCTACATTGCAGC -3'
(R):5'- ATGTACTTTATGCCTGAGAGGG -3'

Sequencing Primer
(F):5'- GCAGCACACATTAAATTCAGTTC -3'
(R):5'- ACGGACTGGATGTCTTGCC -3'
Posted On2016-10-06